Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig892
Contig Information
Length 805 bp
Tissue Shoot with heat shock treatment
Clones 3 Clones [Download: CSV  ,  FASTA ]
whvh10f10    whvh16f24    rwhvh10f10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit stress responsive protein [Triticum aestivum]
Score 1088
Evalue 6.8554e-117
Total Hit Count 106
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig892
TACCGGCCATGGACTACTACCGCGAGACCTACGGCGGGTACGGGATGGCGACGCCCGGGTACGCGGCGCCGGTGCCGTACGGCATGTCGCAGGTGAACAT
CGACGGCAACTACGGCGGGAGGCCGATGCCGCCGCAGCCCACGGTGAAGATCTACTGCCGCGCCAACCCCAACTACGCCATGTCCGTCCGCAACGGCAAG
GTGGTGCTGGCGCCGGCCAACCCCAAGGACGACTACCAGCACTGGATCAAGGACATGAGGTGGAGCACCAGCATCAAGGACGAGGAGGGCTACCCCGCCT
TCGCCATGGTGAACAAGGCCACCGGGCAGGCCATCAAGCACTCCCTCGGCCAGTCCCACCCTGTGCGTCTGGTGCCGTACAACCCAGACTACCTGGACGA
GTCGGTGCTGTGGACGGAGAGCAGGGACGTGGGCAACGGGTTCAGGTGCGTGCGCATGGTGAACAACATCTACCTCAACTTCGACGCCCTCAACGGCGAC
AAGTACCACGGCGGCGTCCGCGACGGCACCGAGGTCGTGCTCTGGAAGTGGTGCGAGGGCGACAACCAGCGCTGGAAGCTCCAGCCGTACTACTGAGCGA
GCCAGCCAGCGCGTGCCATGCATGCGTGCGTGGCTCGTGCACGGTGCACGCACGCGTGGAGATCGACATGCCCAAACCTACCCATGCCGTACGTACGTAT
CTACTAGTACTACTGAAGAAACGATGTGGACTGTCCCGGATAAACAACATGCATGCGTCTCTCGCTACCTACGCCGCAGAATAACGGAGCCAGCTGTGTT
GTGCT
page-top