Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig1050
Contig Information
Length 955 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs10c06    rwhcs10c06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0184800 [Oryza sativa (japonica cultivar-group)] >gi|9558421|dbj|BAB03357.1| putative phosducin-like 3 [Oryza sativa Japonica Group] >gi|113531767|dbj|BAF04150.1| Os01g0184800 [Oryza sativa (japonica cultivar-group)] >gi|215706965|dbj|BAG93425.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215734886|dbj|BAG95608.1| unnamed protein product [Oryza sativa Japonica Group]
Score 674
Evalue 4.00989e-80
Total Hit Count 184
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig1050
GCGCTCGCTCGCTCCTTCGAGGCTCGGCCATGGCGGACTACCACTTCGTGTACAAGGACGTGGAGGGGGCGACCACGCAGTGGGACGACATCCAGCGCAA
GCTCGGCAACCTGCCCGAGAAGCCGCCGCCTTTCAAGCCGCCGCCCTTCGCCCCCCAGGGCCGACGCCGACGAGCAGCCCAGGTCCAAGGAGTGGCTCGA
CGCGCGCGACCCCGACGAGCTCGAGGAGCTCGAGGACGACCTCGACGACGACCGCTTCCTCGAGCAGTACAGGATGGGGGGTAATCGTGTGATTTCCATA
GAAATCTGGAGGATGAGGCTTGCAGAGCTCAAGGAGGCAGCAAAAACTGCCAGATTCGGCACAGTACAGCCCATCACAGGCTCTGATTTTGTGCGTGAGG
TTTCGCAGGCTCCACCGGATGTCTGGGTTGTGGTCTTCCTCTATAAGGATGCGATACCAGAATGTGGGCTGCTTGAGACTTGCCTGGAGGAACTGGCGAC
AAAATATGCAGAAACCAAGTTTGTTAAAATTATTTCCACGGACTGTATTCCCAACTACCCAGATAGGAATGTTCCTACAATACTGGTGTACAACAACAGT
GCTGTCAAAGGGACTTATGTTGGTCTACAGAAGTTCGGTGGAAAGAAATGCACACCTGAATCTGTTGCATTGGCGCTTTGCGACTCAGACCCAGTACTGA
ATGATGGACAAGGTGGTAACAATGTCATGGAAGGCGTTCGCAGGAAGTTCATAGAAAAGGTTGTCTCCCAGCTTGAAACGCGAGAAGACGAAGATGATAG
CGACTAAAACTTACTCCTTTCTGCTAGTTTTGTTTTGGTTCAGTGATATCATTTGGATCCACGGATAGTCTTGGCTTTCCTGATCTTATTTGGTTGTATG
TGTGTGAAAAAACTGAAAGCTGTTTTGACGAGGTTCTGTATAAACTTTGTTCCAG
page-top