Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig796
Contig Information
Length 357 bp
Tissue Shoot with heat shock treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvh10a01    rwhvh10a01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit signal transduction histidine kinase with CheB and CheR activity [Acidovorax avenae subsp. citrulli AAC00-1] >gi|120589552|gb|ABM32992.1| signal transduction histidine kinase with CheB and CheR activity [Acidovorax avenae subsp. citrulli AAC00-1]
Score 77
Evalue 3.52239
Total Hit Count 3
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig796
GCTGCCTGATCGAGGGTCTTTGTATGTATGTACGCACCTGCCTGCATGAGCAGAGCGGGTGCCATGCCATGCATGTAAACCCCTAAATAAAATCTCCCGT
GGTTTTGCTTACATCGTGTTGTTAGATCCTCCTCCTATTAGTGTTGCTTTCGGGTTCTTCTTATGCACGAGCAGGATCAGAGGCCGGTCTTTTGTTCTTG
GTCTTCTCCTCAAACTGTCGTTTTCCTCTTCTCTATGGTCCATTTGCGGCAGTATTTTCTTCTTCTGTTGCCGAGTTCTGTATCAGACTGCCTTGTTTTG
TGGTTTATCCCTATTCATCTTGAAATATAGGTATAGCGCATGAATTTAAAAAAAAAA
page-top