Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig793
Contig Information
Length 741 bp
Tissue Shoot with heat shock treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvh10a09    rwhvh10a09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit NADH-Ubiquinone oxidoreductase subunit 7 [Nicotiana sylvestris]
Score 133
Evalue 3.2531e-06
Total Hit Count 438
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig793
ATTTGCCGCAGTGTGCTTAGATACAATGGGCTGGCAGCTGAGGCTTGGCAGGATGGGGGAGTTAATTAAGGTCGAGGGAGCAGGAAAGAGTTTGTTATTC
GCTATTGGCTTAGTACGGCCTATACATAATAGGGCCATGACGGTTTTGGCAAGGCCTTGAACTTCATATATCCCTTTTTTACTCAATCCAGAATACTGAG
AAAGTCAGATTGAATTATTTTGTCGACCTTTCCTTTGGATTTATTATCATAGGTAGTGTTCGAGATCGCCTCTGTGCGGTGAACGCTCGAATGTAGCTAA
CATCAGTTTTGTCCTCGCGTGGTTGAAGGAGATGCTGCTGCTGGATGGAATGCTTCCGGGGCGCCATGATCCTTCTATCAGGAATAGAATAATCGAGGGC
ACTGACTGACTGCATCAATCATCGCTCAGTGAGCTATTAATTGCCGCCAATAGCGCTTCGCTTGCATGCAAGGCGGCTAATAAAAGCGCTAGGTAGACGC
GCGGAGATGCATTTTGAGTACTGGTGGTACTGGACAAGCTCTAGGGGAATAATCTCTTTCTTATTTCTTTCTTATTTTTTTCCCATGACGACTAGGAACG
GGCAAATTAAGAATTTCACTTTGAATTTTGGACCTCAACATCCTGCTGCTNCAATGGTGTTTTACGATTAGTATTGGAAATGAACGGAGAAGTGGTGGAA
CGTGCGGGAACCACATATTGGATTACTCCATAGAGGGATCG
page-top