Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig780
Contig Information
Length 793 bp
Tissue Shoot with heat shock treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvh10a17    rwhvh10a17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit supt5h protein, putative [Toxoplasma gondii ME49]
Score 84
Evalue 1.78651
Total Hit Count 9
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig780
TCTTGATTCAGTTTTCGCCTCACTGGCACATCCATTCTCTCCAGGCTCTAGCACCGTCTTGCCTCCGGCAGTTGGAGACGGAGCATCTGGTCATGGAAAG
CCGCATCAGGACGTTCGGTGCGGTGGTCATGGCGCACCATGCTGGGTCTACTTCACCATCGTCGTGCTCCGCAGCCGCCTACAGCCGACGCACCGATGAG
GTCCGACATGGAGCACAGTAGCAAGCACCAGTTTGAGGCGAGGTATATCGCATTGGTCTCCTGCTGCTCACAGGCGAGGCCTCGGACGAGCGGCCAAATC
CACGTGAGGTGGATGTTGCAGGTTCGTCCCCAATTATAAAATTTGGAGCCTCCCGCTGAAGGTCCAAGGAGGTGGAAGCATGAACAATGCCCTCATCAAA
TCAATTTAACTGGATTCGAATCGAAGGATGACTTTCGAGAAAAGTTGTTTTACAAATTGAGGAGGGGTAGCAGATGGATGGCATTGCCATGCAGAACTGA
AAACACTGTTGTATGACTACAGACTCTTCACTGGAATAAAAATAGTTATGTGGTGTTTGGTCGGACGTGCGCATTTGCAGCACCATGGGGTGGAGCACCA
TGTATAATTTATGGCTAAATCACATCGGCAGGGAAGCACTATCTAGGACCGTTTAGACACTACCTAGAAGAGTGTTATGTCTACAAAGGTACAGAGTTCG
GACACTAGCTAGAAGAGTGTTCTGTCTACAAAGGTATAGAAAGACAAATAGTTTCATTTCTCATGTTGATAGTCAGTGTAGAAAGACAAGAGT
page-top