Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig774
Contig Information
Length 1243 bp
Tissue Shoot with heat shock treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvh10a23    rwhvh10a23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_025036 [Oryza sativa (japonica cultivar-group)]
Score 1428
Evalue 5.17823e-156
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig774
TATGAAGCTGATTTTCCTGATAGAAGGATCCGCTTTTTTGCCGAGAAGGTTAGTCATCATCCAATGCTGATTGCCTGCCACTCTGAAGGCAAGGGCTGGA
AATTCTGGGGCGACAGCAATGTAAAATCCAAGTTCTGGGGGCAGTCAATTCAAGTTGATCCTGTTGGCGTTTTGACAGTGGAATTTGATGACGGTGAGAT
CTTCAAGTGGAGTAAGGTGACAACAACTATTAATAACCTCATCCTTGGGAAGCTGTACTGCAACCATCATGGAATTATGCACATTAAGGGGAATCGGCAG
TATTCATGTAAACTCAAGTTCAAAGAGCCATCGCTGCTTGACCGCAATCCTCACCTAGTACAAGGCTTCGTGGAGGACAATGATGGAAAGAAGGCTTCAT
TTTTAATAGGAAAATGGGACGAAAGTATGTACTATAGCAATTTAGATACTTCCAAGGTCAAGAGCGCCGATCAATTGCAAGGTGCCTCCCTACTTTGGGA
AAAGAACAAACCTTCTCCCAACCCAACTCGTTACAATCTATCTTCTTTTGCGATCACATTGAATGAGCTGACCCCAGAGCTTCAGGAGAAACTCCCCCCT
ACTGATTCACGGCTAAGACCAGACCAGCGGCATTTAGAGAACGGTGAGTATGAGAAGGCAAATGCAGAGAAGTTGAGGTTGGAACGGCGGCAAAGAATGT
CAACTAAACTTCAAGACAATGGTTGGAAGCCTCGATGGTTTGAGCAGGACGCTGAGGACGGGACATATCATTACAAAGGTGGGTACTGGGAAGCAAGGGA
CCAAGGACGCTGGGACGGATGCCTCAACATATTCGGGGAGTTCTCAGAAACGTGAACGACAGGCATTGCAGCAACACTTGGTTCATCCACCCCAATTGCA
ATGCGACGATCGTCGTCGGAGCAGCATTGCACCCCAAGGCATCATCGGTTTGAGGAAGAAGAGGAGAGAGGAATGCAATGCAGTGGCCAGTGGATATAGA
GGCATTGAAGAAGAAGGCCTTGCCGTCTTGAATGGTAGATAGATATGGATGGCGATGGTCTCCGGCCCTTTATTAGTACCTAAATAATAATGCAGCCATT
CTTTCGTTCGTTTGTGTTGTATGCTTGTTGTTCAGTAGTCTTTTCCTTGTGGGATTGGCTGGTGAAGCAACTCTTATCTGGATGTTCGGTAGATCGTAGC
GTCATTTGTAGAAAGAAAATAGAGGATGAGTTTACAAAAAGTT
page-top