Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig767
Contig Information
Length 801 bp
Tissue Shoot with heat shock treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvh20a09    rwhvh20a09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 1,2-dihydroxy-3-keto-5-methylthiopentene dioxygenase 4 [Zea mays]
Score 772
Evalue 3.02258e-80
Total Hit Count 378
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig767
TTCCGCTCAACATGGCTCCTCAGGTGTGGATGGTTGGGGAGGACGGCGAGGACCTCAAGAACCACGGGGAGCTCCTGCCTCTCTCCAAGCTCCAAGAGAT
TGGTGTGTTATACTGGCATTTGGACCCAAAGAAGCCTGAAAGCGAAGAAGAGCTAGCGAAGATCCGCAAAGACAGAGGATACAACTACATGGACTATCTC
GACATATGCCCTGGAAAGTTGGCAAACTTTGAGGAGAAGCTCAAGAACTTCTTCACAGAGCACATGCATGCCGACGAAGAGATCCGGTACTGCTTGGAAG
GCGGCGGGTACTTTGATGTGCGCGACAAGGATGACAAGTGGGTTCGGATCTGGATAAAAGAAGGGGGCATGATCGTGCTGCCGGCTGGAATTTATCATCG
GTTCACCCTCGACGCCGCCAACCATGTGAAGCTCATGAGGCTCTTCCTGGGAGAACCAGTGTGGACGGCGCACAACCGGCCTCAGGAGGACCATCCGGTG
CGGCAAGAGTATGTCAAGAGGCTCACGGACGACAATGCTGGTCTTGCTCTGGCAGCACACTGAAGTTTGTTTGTGATTCCTCAGCTATGTTTTATAAACA
CCCATGGACATATACATACACTTGGATGAAACCGTGTTGTAATCTTGAAACCAGATAGATATGCTACCTACGTACAGTACTTGTTAATATTCACTAGGTA
ATTGCATGTGCTATACTGCCATATCAAACTCTCAAGTGCTTAAACCCAGTTTTGATTTTAATCCTTTGTATTCAGATTCTAATTAGTAGTGCATAACCGA
C
page-top