Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig718
Contig Information
Length 536 bp
Tissue Shoot with heat shock treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvh10c05    rwhvh10c05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Dictyostelium discoideum AX4] >gi|60467701|gb|EAL65720.1| hypothetical protein DDBDRAFT_0185540 [Dictyostelium discoideum AX4]
Score 82
Evalue 1.2344
Total Hit Count 4
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig718
CCTAGGGAAGCCAGCCAACAGAGCATCATGGACTCCCAAATTTTCGAGACATTTGCCCGGTAGTTAAGTTGATAGTGACTCATCAGTGTTCAGTGCAGTC
AGCCCCTTATTGGGAAGCTACATACATAACAGTTCTGAAGGGAGGAATTGAATGTTGTCAGATAATTGTCGGAAAGCAGGAGTCCGTGTGTGTATCGTTG
TCGTGGTTTACCTGTAACTGTAGTGTTGTACATGGTTAGATCATTGTTCATCCAGAGCAAGAAGGCTTGTAATGTGTTCCGTATTGTTCCGTATACCGTG
TTCGTTACCGTTTAGGACGCTGCTTGCACAGCGCAGCTATACAAGTTTTACTGAGTTAGATTGGCTGGAGGAAAACTACCTCCCCGTGATGTTGTAACTG
AAGTCTGTTGTTGTTGATTAAATTTGTTATAGGAATAAATTAAGTTTATTTGAGTAACCTGAACCAAGTGGTTGGTTTAAGTTGTATCCTGTTTGGAGCG
TAGGAGGAATATAAGAATACCTTCCTAAAAAAAAAA
page-top