Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig715
Contig Information
Length 1156 bp
Tissue Shoot with heat shock treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvh10c09    rwhvh10c09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_35968 [Oryza sativa Indica Group]
Score 900
Evalue 8.31597e-159
Total Hit Count 281
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig715
ATTGGACCGTGTACATCTTTGGAGAAGAAAGGAGCTTTATGTGCAGACACAATTGTCGGTCAGGGAAACACAACAGCATGGAAAATGTGTGGGCTTGATA
GGAATACTTCACTTACAGTATTTTTTGATGTCTCACCGAGTGAACGCTCTGGCCAACCAGGTCATCAAAATCCCGATTTGTACATACAGTTTGTAACCAG
TTACCAACACCCGGAAGGTCAAATGAGAATAAGAGCTACTACTGTATCCAGAAAATGGGTGGATGGTTCTACCAATACCGAGGAACTAGTCGAAGGATTT
GACCAGGAAACTGCAGCTGTTGTGTTGGCAAGATACATCTCCTTGAAAATGGGAAATAGAGGAAGAGTTTGATGCAACACGGTGGCTTGATAGATCTCTC
ATACGACTATGTTCAAGATTTGGGGATTATCGGAAGGATGACCCCTCTTCATTTAGCCTACATTCTAATTTCTCACTGTTTCCTCAGTTTATGTTTAATC
TCCGGCGTTCGCAATTTGTTCAGGTTTTCAATAACAGTCCAGATGAAACAGCCTATTTCCGAATGTTACTCAACCGAGAGAGTGTCACTAATTCAGTTGC
AATGATTCAGCCGTCATTAATTTCATTTTCTTTCGATTCACCTCCTTCTCCTGTATTCCTCGATGTGGCATCAATAGCAGTAGATCGTATACTGCTGCTT
GATGCATACTTCAGTGTTGTCATCTTCCATGGAATGACAATCGCTCAGTGGAGAAACATGTGTTATCAGAATCAGCCGGAGCATCAGCAATTCGCACAAT
TATTACAAGCTCCTCAGGAGGAGGCCCAGGTGATAATAAATGGTCGATTTCCAGTTCCTCGACTAGTTGTCTGTGACCAACATGGCTCCCAGGCAAGGTT
CTTGTTAGCAAAACTGAATCCATCGGCCACATATAATTCAGCACATGATGTTCCACCAGGTTCTGACATCATCTTCACCGATGATGTCAGCTTCCAGGTC
TTCTGTGAGCATCTACAAAGGCTGGCTGTTCAGTCGTAAGGAAATGCATGCAGAGTTGTACTCCCAAATTGATTGTTACTAGCTATTCGACGTTTGTTTA
CCTATCTGGCTCGCTCATAGTTTTGACTGTCTTTTTGGCCATGTGTCTTTTCATCA
page-top