Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig665
Contig Information
Length 590 bp
Tissue Shoot with heat shock treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvh10d04    rwhvh10d04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit immunoglobulin heavy chain variable region [Homo sapiens]
Score 91
Evalue 0.144662
Total Hit Count 34
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig665
CAAAATCTCTGTTGCTGCCGCGGATGGCAGCGACAAAGACGACGAAGTGGCTACTGTGGAGGTCGGCTTGTGCGGCGCGGCGTCTGTCGAGGCAGGGGCA
GTGATTGCAAGGGAAGACGGCGCCGGCGAGGTCTGGGGCCGGCGCTCGGGCGGCTGCGACGAGCTGCCGGAGCAGGGTGGCGGCGGAGTCCAGGAGTGTG
GTGCTCTACGGGCTTCTTGTGGGTGCGGGTGTGGCGCCGCGACTGAAACGAGGTGGCTGTGATCTCGTGCTGCTGCATCTTCTGTTGCTACGAGCTAGTA
CATCTGTGGGACTTTGAGCGACGGTGAGATGCGTCCTCTTGCTTGTGTGGTGGTGGTGCTTCTCGATTCTGTTCTTTGGATCCACAAGTGACCAAAGTTT
AGCATTGCACGAGGTTCAGCTTTCTTCTCCTCTTCCCTTTAAGTTACATGGTGTGTAGCTGCTGAAAAATGTGAATGTTTGCTTGGGAAATTGGGGATCA
ACTGATGTATCTGCTGGACAATGCTAATATGCTTAGCTTGTTGGATTCGGAGACAGCGACGGTCGGTCCTGTGTTGCCCCAAAAAAAAAA
page-top