Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig611
Contig Information
Length 1310 bp
Tissue Shoot with heat shock treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvh10d06    rwhvh10d06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit pre-mRNA cleavage complex II protein Clp1 [Zea mays]
Score 1496
Evalue 7.28513e-164
Total Hit Count 431
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig611
TCGATGCACGGAGGGCGAGGGCGAGGGCAGCGCAGGGAGGCGACTTGGAGGCCTCACAGGGACCTAGAGTGATTGTTGTGGGGCCAACTGATTCTGGAAA
AAGCACTCTGTGCAAAATGCTCCTTAGCTGGGCTGCCAAACTGGGATGGAAGCCTACATATGTGGATTTAGATATTGGCCAGGGTTCCATAACCATACCT
GGATGTATTTCTGCTACACCAATAGAGAAACCCATAGATATAGTTGATGGGATTCCTTTGGAGATGCCGCTTGCATACTTTTATGGCCATCCAAATCCAA
GTATTAATCCAGATGTTTACAAAGCGCTCATGAGAGAGCTAGCTCAAACATTAGAGACACAGTTCTCTGGGAATGCTGAATCTAGGGCGGCCGGTATGGT
TATTAACACAATGGGGTGGGTTGAAGGCCTTGGCTATGAGTTACTTCTTAATGCAATTGACATCTTCAAGGCTAATGTAGTGCTGGTATTGGGACAGGAG
AAGCTCTGGAAGATGTTAAAAGATGCAGTACAAAGTAAGCCCAATATCGATGTCGTAAAACTTCATAAAATTCTGAGGGGTGTTGTCCTAAGGAATTCAA
AATATCGTCAAAAGACTAGGAGCTTTCGTATCAAGGAGTACTTTTATGGGATTGCAAACGATCTGGCACCACATTCAAATGTAGTCAACTTTAGTGATGT
TTCTGTTTTCAGAATTGGTAGTGGACATCAAGCTCCACGGTCAGCTTTACCAATTGGTGCAGAGCCTGTGGCAGATCCCACTCGGCTTGTTGCTGTCAAC
ATCAGCACTGATATGGTCCACACAGTGCTTGCTGTTTCTTATGCGAAGGAACCTGATGAAATAATTTCGAGCAACGTTGCCGGATTCATCCATGTCACAG
ATGTTGACATCCAAAGGAAGAAGCTGACGTACATCGCGCCTTGCCCAGGAGACCTGCCAAGCAGGCTGTTAATCGCGAGCTCCCTGACATGGTACGAGCA
GGCTTGACCCGGTTCGAGGTTGGACATTGTAGGTAGGTAACCAGATGGCTGATGACATGTTGTAACGCCGAAATGGATACTCTGTGCATTTGATAACTGG
AACACTGCTGGTAAAGCTGAAAAGCTGAATGGGTTGGACGATATCTCAGGCATCTTGCTGCGAAGCTTTCTGCTGACTTGCTTATGCTTTCTATGCTGCT
GTGGCGGCGAAGATACAAATAGTTAGGTCAATGAAAGATTGGTGTGCTCTTTTGTATCGCTNNTGGGAACTAAGATATACTAGAAGACGAGTCCCTTTGG
CCTCTTCTCA
page-top