Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig584
Contig Information
Length 1033 bp
Tissue Shoot with heat shock treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvh10d24    rwhvh10d24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_017237 [Oryza sativa (japonica cultivar-group)]
Score 1429
Evalue 3.00246e-156
Total Hit Count 305
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig584
AAGGTCGTCCGTCAGCTGCTGCTACTGCTCCTGGCAAAGGTTTTGGTATGAAATTAGGCAAATCACAGAAGACAAATCAGTTCCTACAATCTTTGAAAGC
TGAAGGAGAAGTCATTTTGGAGGATGCACAACCAAGTTCAGTTTCTTCAAGGGCCTCGCCTCTTATACCAAGCGATCCCATCACAGTGACTATTGAAGAG
AAACTTAATGTAATAGTTAAAAGAGATGGAGGTGTTAATAACTTTGATGTGCAAGGAACCCTTGCTCTTCAGGTCCTTAATGATGCAGATGGATTTATCC
AGTTACAGATCGAAAACAAAGATGTACCTGGACTCAGCTTCAAAACACACCCCAATATCCACAAGGAGTTGTTTAACAGCCAGCAAATTGTTGGAGCAAA
AGATCCAAACAGGCCTTTCCCAAGTGGTCAAAATGAAACACCACTTGTGAAATGGAGAATCCAGGGGATGAATGAATCGAATTTACCTCTGTCAGTTAAC
TGCTGGCCCTCGGTATCTGGAAATGAAACCTATGTCAACATTGAATATGAGGCTTCAGAGATGTTTGACCTGAACAATGTTGTCATATCTATTCCTCTAC
CTGCACTTCGGGAGGCTCCAACTGTTAAACAGATTGATGGAGAGTGGAAGTATGACCCAAGAAACTCTGTATTGGAATGGTCCATCATCCTTATTGATCA
GTCAAACCGCAGTGGGTCGATGGAATTTATTGTTCCCCCGGCTGATCCGTCAACATTTTTCCCCATCTCTATTGGATTTGCTGCTTCCAATACTTTCAGT
GATTTGAAGGTCACTGGAATTCATCCTCTGAAGGAAGGCAACCCTCCAAAGTATTCACAGAGGGTCCGTTTGGTTGCTGCGAACTATCAAATAGTCTAAA
GCCATAATTAAAGCAGTTACTGCTGTTTCTTGTTAGTGGCACAAGGAGTATAATTTTGCATCAAATTTGTTTAAATATGTGTGATTTGGCCTGTCCCATA
CGTAGCGTGTCGCACCATTGAGAAATAAAAGCA
page-top