Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig549
Contig Information
Length 788 bp
Tissue Shoot with heat shock treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvh10e08    rwhvh10e08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_11040 [Oryza sativa Indica Group]
Score 826
Evalue 1.60531e-86
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig549
GGCTCCGCCAAGGCCATCATCCACCGGGACGTCAAGTCGGCCAACATCCTCCTCGACGAGAGCTTCATGGCCAAGGTGGCCGACTTCGGGCTGTCCAAGA
ACGGGCCGGAGCTGGACAAGACGCACGTGAGCACCAAGGTGAAGGGCAGCTTCGGGTACCTGGACCCGGAGTACTTCCGGCGGCAGATGCTGACGGAGAA
GTCGGACGTTTACTCCTTCGGCGTGGTCCTGCTGGAGGCGCTCTGCGCCCGCACCGTCATCGACCCGACGCTGCCGCGGGAGATGGTGAGCCTGGCGGAG
TGGGCGACGCCGTGTCTCAGAAACGGCCAGCTCGACCAGATCGTCGACCAGAGGATCGCCGGGACGATACGGCCGGGGTCGCTCAAGAAGCTCGCGGACA
CGGCCGAGAAGTGCCTCGCCGAGTACGGGGTGGAGCGGCCCACCATGGGGGACGTGCTCTGGTGCCTCGAGTTCGCGCTGCAGCTGCAGGTGGGGTCGTC
AGACAGCTCGGACGTCGACACCATGTTGCCGCCGGCGCCGCCCGTGCCCGTGAAAACGCCTGAGGTTCAGCGTCGCCTGTCCGCCGCTACCGTGGCGACT
GACGCTGCTGCCATGACCACCAACTTGGGTGACCTAGACGGAATGTCCCTGAGCGGAGTATTCTCGAACATGATCAAGAGCGACGAGGTCAGGTGAAGCC
AAAAGGTGCTTCGTCCACGTTGTACAAACTGAAGCACGTGTATATTCGGTCAATTTAGTGTTTATAGCATGTAGTACATGACAAACGA
page-top