Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig507
Contig Information
Length 981 bp
Tissue Shoot with heat shock treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvh10e13    rwhvh10e13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_00633 [Oryza sativa Indica Group]
Score 843
Evalue 2.4973e-88
Total Hit Count 445
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig507
GCGTTGATCCCGCTTCACAAGCCTAAGACAGTGGGTGTATATCTGCCGCAGCTGACCTACTGCATAACACAATTTATAGAGAAGGAACCCAAGCTTGCAG
GGACTGTGATTAGGGGTCTGTTGAAGTACTGGCCAGTTACAAATAGTCAGAAGGAGATGATGTTCTTGGGGGAGTTAGAAGAAGTGCTTGAGTTGATTGA
CATGGCTGAGTTTCAGAAGTGCATGGTGCCATTATTCCGGAGGATTGCGACTTGCCTCAATAGCTCCCATTTTCAGGTTGCTGAGAGAGCCTTATTCTTG
TGGAATAATGAACATTTGTTCGATATGATCTCCCAAAACCGTCAAGTGATTGTACCAATCGTATACCCAGCTCTGGAGAGAAATGCACGTTTGCACTGGA
ACCAATCGGTTCTCAACGTTACTATGAATGTGAGAAAAATGTTCTTCGACATGGACGAGAGATTGCTCCTGACTTGCCAGAGCAACTTCCAAGCGGACGA
AGAGAAGCGAGCCGCAGCGGAGGAGCATCGAAGGCTCACATGGGAGCAACTGGAGCGGAATGCCGACCCTGCATTCCGACCAGCCAACGCGCCCCCTTCT
TCGGCCCCTCCGAGAGTCCCCACCGTGACATGACACGGGTCCGAATATACTCCGCCCCACCTTCCCTTGCTTCCTAGCTAGCTAGATGAAGTTGCTTGCT
TCTCTGGGATACAGAAGGCGTTTTGTTACCTTTGTAAACCCCCCCACCCTTGCCACAAAGTCTGTAATTAATAGTTGTTGATTCGAAGACAAATGGATTC
TTGATTTTTTCCTTTTCTTTTTTGCGGCGAATTCTCGAGTAATGGGCATTGCTTTCTTGGCAAAATCTTGATTGAGATTTACCCCCCAGTGTTCTGTGAA
GAGTGGGCGCTACTGACTTTGTATGTTAGGAGTGGCAATTTTGCAGCCATATTTTTTTTGTATGTGAGATTTCCATTCTTT
page-top