Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig495
Contig Information
Length 817 bp
Tissue Shoot with heat shock treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvh10e16    rwhvh10e16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit plastid-lipid associated protein 3 [Zea mays]
Score 812
Evalue 7.12584e-85
Total Hit Count 205
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig495
AGCGGTGCTTGGTGGACACGGTGTACGGCTCCGGCCTGGGCCTTAAGACGTCCTCGGAGGTCAGGGGGGAGGTCGTGGAGCTCGTGGCCCAGCTCGAGGC
TTCCAATCCCACGCCCGCGCCCGTCCAGGCGCCAGAGCTCGACGGAAACTGGATACTCCTGTATACAGCATATTCTGAGCTTCTACCGATTCTGCTTGCC
GGGGCAACACCATTCACCAGAGTTGATAAGATATCCCAAGAAATTGACTCGAGAAGCATGACGATAATTAATGCTTCAACTATTTCGACTCCATTTGCTT
CGTTTTCATTTAGCGCAACTGCTTCTTTTGAAGTCCAAACTCCATCAAGGATAGAGGTCCAATTCAAAGAGGGGAGCTTCCAGCCTCCTGAGATATCATC
ATCAGTAAATCTACCTGAACAGATCGTCATATTCGGGCAGAAGTTCAGCCTGGGGCCTGTTAAGGAGCTGCTGGAGCCTTTGCAGCGAGCATTTGCTAGC
ATTGCAGGGTCCATATCTGGGCAGCCACCCCTCAAGGTACCGATTCCCGGAGACAACAAGGCCAAGTCGTGGCTTTTGACAACCTACCTGGACAAAGACT
TGAGGATTTCAAAAGGCGATGGAGGTGGCGTGTTTATTCTTGCCAAAGAGGGGAGCCCTTTACTAGATTAACTGTACATGTGTAATAGGTGTCATTATTC
ATATCTGCAAGGTTGAAAACCACAGCTGCAAGCCTACAACGGGAGCATTCTTCTCCCTCTTTGATACACAATTTTCTGGTGGTTTTGAGTCTGGCAGAAT
CAACTAAATATTGTCGG
page-top