Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig493
Contig Information
Length 1462 bp
Tissue Shoot with heat shock treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvh10f04    rwhvh10f04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_029565 [Oryza sativa (japonica cultivar-group)]
Score 988
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig493
TAAGTGCTCTTAAGGGAGAGAATGTTGATGAGCTATTAGAGACTGTCATGCTTGTTGCTGAGTTGCTAGAATTAAAAGCCAATCCTCATAGAAATGCAAA
GGGTACGGTTATTGAAGCATGTCTTGACAAGGCTAAAGGACCTCTTGCCACCCTAGTTGTACAGAATGGAACCTTGAATAAGGGCGATATTCTTGTTTGT
GGTGAAGCTTTTGGAAAGATCCGTGCAATGTATGATGATCGTGGAAGCCTTGTAGACCAAGCAGCGCCATCCAACGCCGTGCAGATTATTGGCTTGAACA
ATGTACCCCTTGCTGGTGACGAATTTGAGTCTGTTGATGACCTTGATGTTGCACGCGAAAGGGCAAACGCGCGTGCCGATGCAATGAGAATTGAAAGGAT
AAATGCGAAAGCTGGGGAAGGAAAAGTCACTCTGTCATCCATTGCAGCTTCCATTTCATCTGGGAATCAAGTAGGGATTGATACGCATGGGTTAAATGTC
ATACTTAAAGTTGATTTTCAGGGTTCAATTGAGGCCATTAGGCAAGCCATTCAAGCGCTGCCTCAAGAAAATGTCTCTTTGAGATTCCTACTTCAAGCTC
CAGGAGATGTGAGCCTCAGTGATGTTGATCTGGCTGTTGCTTCGGAAGGAATTGTATTTGGTTTTTAATGTCAAAGCTCCGGGGCCAGTTAAGAAATATG
CTAAGCAGAAAAGTGTGGAGATTCGATTGTACAAAGTGATCTATGATTTGATAGATGATTTACGCAATGCCATGGAAGGGCTTCTTGACCTTGCTGAGGA
GGAGGTACCACTCGGTTCAGCCAAAGTTCGAGCTGTTTTCAGTAGTGGCAGTGGAAAGGCAGCGGGTTGCATGGTTACTACAGGGAAAGTTGTGGAAGGC
TGCAATGTTCGGGTTCTTCGTAAAGGAAAAGAAGTTTATGTGGGTACACTTGATTCCTTGAGACGGGTGAAAGAAACTGTGAAGGAGGTTGGTGCGGGGC
TAGAATGTGGTATTGGGGTAGATGACTTCGACGATTGGGAGGAAGGTGACGTCCTTGAGGCATTCAACACCGTGAAGAAGGCAAGAACGCTTGAGGAAGC
CTCTGCGACTGTGACTGCTGCTCTCAAGGGTGCAGGCGTCCAGGTGTAGATGTTGCAAAGCTGATAAGCGAGTAACAACTGCAGCAGCCATTTTTTCTTT
TGGCGTCGAAGCTGGAGTGCGTTGGCCACATTCCCTAAGAATGACACTCAGGTACTTGAAAGACAGAACCTATACATGCCACATGACGTGCCTGCGTTGC
TGCCGGGAGCCTGCCTGTGCTGGACCGTATTGTATCCCGCCTCTCAAAGCTGCATGTGCTACTGTATGTTGATGTACATAGAGAAGATTACATCTGCTGT
TTTTAGTTTGCCTCTAACAGGTAGATAAAGGGTGTGTGTGTGTTTCTAGTTTTATGCCTTTT
page-top