Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig414
Contig Information
Length 266 bp
Tissue Shoot with heat shock treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvh10f17    rwhvh10f17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit chaperonin [Zea mays]
Score 130
Evalue 2.53776e-06
Total Hit Count 289
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig414
CTGTACTCCAAGTATGCAGGAAGCGAGTTCAAGGGTTCGGAAGGCGAGTACATTGTTCTCAGGTCATCCGACGTGATAGCGGTGCTGTCATCATAAGCTT
GCCCTGCCCTACGTGAACTAGGAATTTTGATATTTAGTCCAAAACCTTGTTTGGTTATTGCTCTTTGCTTGTGATTGGTGAACTGTGAATTGCTTCTTCG
CTCTATCGTGGAAATGCTGCTTGATAGTTTTAATAAGATGACGGCTTAGACTTCAGAAAAAAAAAA
page-top