Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig402
Contig Information
Length 1239 bp
Tissue Shoot with heat shock treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvh10g06    rwhvh10g06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit galactinol synthase [Triticum aestivum]
Score 1659
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig402
ACACACATCCCATCCATCCTTTGAGTTGAAGCAAGACAAGAGAAACAATGGCTCCCATGCTCAAGCGGATCGCCGAGGACGAGCCCAAGAAGGCGGCGTA
CGTGACCTTCCTCGCCGGCTCCGGCGACTACTGGAAGGGCGTGGTGGGCCTGGCCAAGGGCCTCCGCGCCGTCAAGTCGGCCTACCCGCTCGTGGTGGCC
GTGCTCCCCGACGTCCCCGAGGACCACCGCCAGAAGCTGCTCGCCCAGGGCTGCCTCGTCCGCGAGATCGTGCCCGTCTACCCGCCGGAGAGCCAGACCC
AGTTCGCCATGGCATACTACGTCATCAACTACTCCAAGCTCCGCATCTGGGAGTTCGTGGAGTACGAGAGGATGGTGTACCTGGACGCGGACATCCAGGT
GTACGACAACGTCGACCACCTCTTCGACCTCGAGAAGGGCAGCTTCTACGCCGTCAAGGACTGCTTCTGCGAGAAGACGTGGAGCCACACCAAGCAGTAC
GAGATCGGCTACTGCCAGCAGTGCCCCGACAGGGTCGTCTGGCCGGAGCGCGACCTCGGCGTGCCCCCGCCGCCGCTCTACTTCAACGCCGGCATGTTCG
TGCACGAGCCCAGCATGGCCACCGCCAAGGCCCTGCTCGACAAGCTCGTCGTCACCGACCCCACCCCCTTCGCCGAGCAGGACTTCCTCAACATGTTCTT
CAGGGACGTGTACACGCCCATTCCGCCCGTCTACAACCTCGTCTTGGCCATGCTCTGGAGGCACCCCGAGAACATCCAGCTCCACAAGGTCAAGGTCGTC
CACTACTGTGCAGCGGGTTCGAAGCCGTGGAGGTACACCGGCGAGGAGGCCAACATGGACAGGGAGGACATCAAGATGCTGGTCAAGAAATGGTGGGCCA
TCTACGACGACGAGAGCCTCAACTACAAGCCTGCCGCCGACCCGCTGCGTGCTGCCCTCGCCGAGGTCGTCGCCGTCAAGTCCTTCCCGGCGCCCTCGGC
TGCATAGGCTCGCTCGCTGCAAAAAGGCGTGTAATGGTCCTTAATAAATAGGAATATATCCAAAATTAGGGATTTCCTCAGTACGTAATATCGTCGTCGA
TTCAGTATCTGCATGTTTTGGTATTGTAGATCATCAATGGATCATATATATACAGTGTTCTTTTCTTGATTGAGGTACGGTCATAGTGTTTTTCTTGATT
CAGTATCTACACGTTTTGGTATTGTAGATCAATCAATCA
page-top