Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig364
Contig Information
Length 956 bp
Tissue Shoot with heat shock treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvh3e10    rwhvh3e10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_27446 [Oryza sativa Indica Group]
Score 844
Evalue 1.82249e-88
Total Hit Count 101
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig364
GTTTCAGTTGCCCTTTCTCGAATCCTGCAGGGATCACCACAACATGGCCCTATTCTTGACCCATCAGAAATTTTGATTGCGATTCATGTAATAGATCCTG
AAAAAGAAGGAATACCACTGAAAAAGGTTATGGATGCATGTGCTGCCTGCTTCGAGCAAAGGACAACATTCACTCAGCAAGTTTTGGCAAAAGCACTAAA
CCAACTGGTTGAACAGATTCCCCTACCTTTGCTGTTCATGCGAACTGTTATGCAAGCGATAAGTGCATTTCCTGCCTTGGTGGATTTTGTGATGGAGATC
ATGTCACGCCTTGTTAACAAGCAGATATGGAAATATCCGAAGTTATGGGTAGGATTCCTGAAGTGTGCTATCCTGATAAAACCTCAGTCCTATGGTGTGT
TACTGCAGTTACCAGCTCCACAACTCGAAAATGCCCTGAATAAGAACCCTCTACTGAAGGCGCCCTTGGTCGAGCATGCCAGCCAGCCAAACGTGCGATC
AACTCTCCCGAGATCTATCTTGGTGGTTCTGGGTCTCGCCGAAGATCAACAGCAGCAGCCCGCACCTGAGGCACAGAGCAGCCAGAACCAGGCCGCGGAG
ACCAGCAGCTCCGCCGCAGAGGCCACGACGGAAGTAACTCAGGAATCCTCCGCCGCCAGTTGACATTTCCCCCGCAGCAGTGCTGGCCTTCTCTGTATTT
GCTGGAACAGAATGGAGGCATTTGGCAGGCGACGAAGTGCTGCCTGCATTAATGTAGTACCGGGAAAGATGGCATGGCAAGACCATGTGGCGAAGCAGTG
TTCAGCTGCTGCGCGATTTGTATAAAACATTTATTACGCTAAGAATTTGAAAATAGTGGTAGGAGAAAGTTGTTGCTGAGCCCTGCTGTTCTTTTGTTTT
GGTAACCTGTAATTCCAGTCCACTAAAGTGGTATGTAGAACATTAAACAAGGCTGT
page-top