Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1517
Contig Information
Length 1037 bp
Tissue Shoot with ABA treatment
Clones 158 Clones [Download: CSV  ,  FASTA ]
whva11c01    whva11d11    whva11g11    whva12a08    whva13c22    whva14c24    whva14d11    whva14n16    whva15d02    whva15d08    whva15o20    whva15o22    whva15p17    whva16c10    whva16e11    whva16f01    whva16g01    whva16l01    whva16n12    whva17b08    whva17c23    whva17j08    whva17o24    whva18d18    whva18d22    whva18i01    whva18k22    whva18l19    whva18l20    whva18m08    whva18m09    whva19h19    whva19n01    whva19n02    whva20b21    whva20e20    whva20f05    whva20h21    whva20h22    whva20j12    whva20o09    whva10b23    whva1b03    whva1b04    whva1c11    whva1h10    whva1l08    whva1n16    whva2h15    whva2i08    whva2l12    whva2p03    whva2p05    whva3g22    whva3i12    whva3j11    whva3l24    whva3m19    whva3o04    whva4a03    whva4b14    whva5n03    whva5p21    whva6b03    whva6b04    whva6p05    whva8k19    whva8p23    whva9j16    whva9j20    rwhva15d02    rwhva15d08    rwhva15o20    rwhva15o22    rwhva15p17    rwhva16c10    rwhva16e11    rwhva16g01    rwhva16l01    rwhva16n12    rwhva16n23    rwhva17b08    rwhva17c23    rwhva17i04    rwhva17j08    rwhva17o24    rwhva18c06    rwhva18d18    rwhva18d22    rwhva18i01    rwhva18k22    rwhva18l19    rwhva18l20    rwhva18m08    rwhva18m09    rwhva19c05    rwhva19h19    rwhva19n01    rwhva19n02    rwhva20b21    rwhva20e20    rwhva20h21    rwhva20h22    rwhva20j12    rwhva20o09    rwhva11c01    rwhva11d11    rwhva12a08    rwhva12h03    rwhva12i20    rwhva13c22    rwhva13d09    rwhva13e11    rwhva13l04    rwhva13l18    rwhva13p22    rwhva14c24    rwhva14d11    rwhva14d22    rwhva14n16    rwhva14o09    rwhva10b23    rwhva1b03    rwhva1b04    rwhva1c11    rwhva1h10    rwhva1l08    rwhva1n14    rwhva1n16    rwhva2c06    rwhva2h01    rwhva2h15    rwhva2i08    rwhva2p03    rwhva2p05    rwhva3g22    rwhva3i12    rwhva3j11    rwhva3l24    rwhva3m19    rwhva3o04    rwhva4a03    rwhva4b14    rwhva5j02    rwhva5n03    rwhva5p21    rwhva6b03    rwhva6e10    rwhva6j02    rwhva6p05    rwhva7e11    rwhva7e12    rwhva7i09    rwhva8c06    rwhva8i07    rwhva8k19    rwhva9j16    rwhva9j20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Secale cereale]
Score 919
Evalue 4.16421e-97
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1517
TATTATATTGTTGGCCAACATTCTGTGGGGCCATGTTTACAACCATACATTTCAGGGATACAAACTAAGACAACGTCCAACCGTCCACTATTAATAAAAA
GTATCCCCTCTGTAAACTAACATAAGAGCGTTTAGATCACTAAAGCAGTGATCGAAACGCTCTATATTAATTTACAGAGGAAGTAATAAGCACGGTGGTG
GAGATATTTTCCATTGGTTACCATTAAAACGTATATAGTCGACATATTGTATAATATTATGCGTCCGTTCATATACATAGCCACCGCATAGCATTCTCAT
ACGAGCATGCTTTCTCGAGCCATGTTGGTACATGAACATGGACATACACATATTCTTAGGAACAAATAAGAAAGATAAATGGAGAAGGAAAACCCAAAGC
AATGTCAGAGTTGACAAAACTGCAATGGCACTTTATATATGGCCTGTCGTGAGTGAGCTGTTTAGGCCTTGCCGGACTCCTCGCAGCCCGGTGGCTTGAA
GGCGATGAAGCTGACGCACTGCACCTGGCGCATGTTGTCGAATCCGATGATGCGGACATACGCGTCAGGGTACTCCTTCTTGACCTCCTCCACCTCGTTG
ATCACTTGTGTGGCGTCGGTGCACCCGAACATAGGCAGCTTCCACATTGTCCAGTACCGGCCATCATAGTACCCAGGGGATGCGTTGTGCTCACGGAAGA
TGAACCCAACCTTGCTGAACTCGAGGCAAGGCACCCACTTGGAGCGGATCAGGTAGTCGACCTGCTTGAGGAGGGCCTCCGTGCTGAGCGGTGGCAAGTA
GGACAGGGTCTCGAACTTCTTGATGCCCTCAATGGGCCACACCTGCATGCACCTGATCCTTCCACCGTTGCTGACGCTGCCGAGGCTAGCGCCGTTGGAG
CGGCGGCTGACGGGGAGGCCGGCGGTGGACTTGAGCCCCTGGAAAGGAGCGACGGAGGTGGCCGACGAGGCCATCACGGTGGGGGGCCATGGCTGTACTA
TGTAGGTATATAGCTTGCTAGGAGGAGGCCGGCACGA
page-top