Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1514
Contig Information
Length 883 bp
Tissue Shoot with ABA treatment
Clones 119 Clones [Download: CSV  ,  FASTA ]
whva11b16    whva11b20    whva11d13    whva11h15    whva12j12    whva12p17    whva14b03    whva14g08    whva14l04    whva14l15    whva14m11    whva15b05    whva16a17    whva16c01    whva16f22    whva17a10    whva17c10    whva17d04    whva17i01    whva17j01    whva17p23    whva18b07    whva18f13    whva18f14    whva18k23    whva19a06    whva19f11    whva19l18    whva20c10    whva20c21    whva20e18    whva20f15    whva20f16    whva20f24    whva10a17    whva10o23    whva2b21    whva2d14    whva2e18    whva3d21    whva3d22    whva3h15    whva3n06    whva3o01    whva4a05    whva4j22    whva4n08    whva4n19    whva6l15    whva7l05    whva8b21    whva8e24    whva8h20    whva9g07    whva9o01    rwhva15b05    rwhva15k02    rwhva16a17    rwhva16c01    rwhva16f22    rwhva16g04    rwhva17a10    rwhva17c10    rwhva17d04    rwhva17i01    rwhva17j01    rwhva17p23    rwhva18b07    rwhva18f13    rwhva18f14    rwhva18k23    rwhva19a06    rwhva19f11    rwhva19l18    rwhva20c10    rwhva20c21    rwhva20e18    rwhva20f15    rwhva20f16    rwhva20f24    rwhva11b16    rwhva11b20    rwhva11d13    rwhva11h01    rwhva11h15    rwhva12j12    rwhva12p17    rwhva13b03    rwhva14c20    rwhva14l04    rwhva14l15    rwhva14m11    rwhva10a17    rwhva10o23    rwhva10p06    rwhva1c24    rwhva1h01    rwhva2b21    rwhva2d14    rwhva2e18    rwhva3d21    rwhva3d22    rwhva3h15    rwhva3k04    rwhva3n06    rwhva3o01    rwhva4a05    rwhva4j22    rwhva4n08    rwhva4n19    rwhva6l15    rwhva7i10    rwhva7l05    rwhva8b21    rwhva8e24    rwhva8f11    rwhva8h20    rwhva9g07    rwhva9o01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Secale cereale]
Score 919
Evalue 3.21853e-97
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1514
AGTATAAGCACGGCGGTGGAGATATTTTCCATTGGTTACCATTAAAACGTATATAGTTGACATATTGTATAATATTATGCGTCCGTGCCATATACATAGC
CACCGCATAGCATTCACATACGAGCATGCTTTCTCGAGCCATGTTGGTACATGAACATGGACATACACATATTCTTAGGAACAAATAAGAAAGATAAATG
GAGAAGGAAAACCCAAAGCAATGTCAGAGTTGACAAAACTGCAATGGCACTTTATATATGGCCTGTCGTGAGTGAGCTGTTTAGGCCTTGCCGGACTCCT
CGCAGCCCGGTGGCTTGAAGGCGATGAAGCTGACGCACTGCACCTGACGCATGTTGTCGAATCCGATGATGCGGACATACGCGTCAGGGTACTCCTTCTT
GACCTCCTCCACCTCGTTGATCACCTGTGTGGCGTCAGTGCACCCGAACATAGGCAGCTTCCACATTGTCCAATACCGGCCATCGTAGTACCCAGGAGAT
GCGTTGTGCTCACGGAAGATGAACCCAACCTTGCTGAACTCGAGGCAAGGCACCCACTTGGAGCGGATCAGGTAGTCGACCTGCTTGAGGAGGGCCTCCG
TGCTGAGCGGTGGCAGGTAAGACAGGGTCTCGAACTTCTTGATGCCCTCGATGGGCCACACCTGCATGCACCTGATCCTTCCACCGTTGCTGACGCTGCC
GAGGCTAGCGCCGTTGGAGCGGCGGCTGACGGGGAGGCCGGCGGTGGACTTGAGCCCCTGGAAAGGAGCGACGGAGGTGGCCGACGAGGCCATCACGGTG
GGGGGCCATGGCTGTACTATGTAGGTATATAGCTTGCTAGGAGGAGCTCCCGAGCTCGGCAACCGCGTGCAGAGAGTCCGTGT
page-top