Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1513
Contig Information
Length 858 bp
Tissue Shoot with ABA treatment
Clones 117 Clones [Download: CSV  ,  FASTA ]
whva11a03    whva11g20    whva11i11    whva11k01    whva11k02    whva12b16    whva12c14    whva12g24    whva12i22    whva13a04    whva14h18    whva15a12    whva15b13    whva15b14    whva15m15    whva16m17    whva16m18    whva17g22    whva17h03    whva17h13    whva17i22    whva18d14    whva18h10    whva18i22    whva18j09    whva18p11    whva19i22    whva19m04    whva20a09    whva20d02    whva20e04    whva20f07    whva10a03    whva10g22    whva10l02    whva2b13    whva2e04    whva2m10    whva2o18    whva2p09    whva3f15    whva3g19    whva3k11    whva4d09    whva4e05    whva4g08    whva4o23    whva5c03    whva5o22    whva5p09    whva6n22    whva7a05    whva7a06    whva7f13    rwhva15a12    rwhva15b13    rwhva15b14    rwhva15m15    rwhva16m17    rwhva17g22    rwhva17h03    rwhva17h13    rwhva17i22    rwhva18d14    rwhva18h10    rwhva18i22    rwhva18j09    rwhva18p11    rwhva19i22    rwhva19j09    rwhva19m04    rwhva20a09    rwhva20d02    rwhva20e04    rwhva20f07    rwhva20i05    rwhva11a03    rwhva11g20    rwhva11i11    rwhva11i12    rwhva11k02    rwhva12b16    rwhva12c14    rwhva12d01    rwhva12g24    rwhva12i22    rwhva12j06    rwhva13a04    rwhva14b14    rwhva14h18    rwhva10a03    rwhva10g22    rwhva10l02    rwhva10p21    rwhva2b13    rwhva2e04    rwhva2o18    rwhva3f15    rwhva3g19    rwhva3k11    rwhva4d09    rwhva4e05    rwhva4g08    rwhva4o23    rwhva5c03    rwhva5o22    rwhva5p09    rwhva6n22    rwhva7a05    rwhva7a06    rwhva7b07    rwhva7f15    rwhva7h14    rwhva7h15    rwhva7p11    rwhva8f15    rwhva8i10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Secale cereale]
Score 919
Evalue 3.09236e-97
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1513
TTTTTTTTTTGCGGTGCCAAAGATGTTTCTCATTATTAATTACCCGAATACATAGTCGACAGATTGTATAAATATATTATGTGCATGTGCATATACATAG
CCCACCGCATTGCATTCACATACGAGCATGCTTTCTCGAGACATGTTGGTACATGAACATGGACATACACATATTCTTAGGAACAAACAAGAAAGATAAA
TGGAGAAGGAAAACCCAAAGCAATGTCAGAGTTGACAAAACCGCAATGGCACTTTATATGTGGCCCGTGGTGAGTGAGCTGTTTAGGCCTTGCCGGACTC
CTCGCAGCCCGGTGGCTTGAAGGCGATGAAGCTGACGCACTGCACCTGGCGCATGTTGTCGAATCCGATGATGCGGACGTACGCGTCAGGGTACTCCTTC
TTGACCTCTTCCACCTCGTTGATCACCTGTGTGGCGTCGGTGCACCCGAACATAGGCAGCTTCCACATTGTCCAGTACCGGCCATCGTAGTACCCAGGGG
ATGCGTTGTGCTCACGGAAGATGAACCCAACCTTGCTGAACTCGAGGCAAGGCACCCATTTGGAGCGGATCAGGTAGTCGACCTGCTTGAGGAGGGCCTC
CGTGCTGAGCGGTGGCAGGTAGGACAGGGTCTCGAACTTCTTGATGCCCTCGATGGGCCACACCTGCATGCACCTGATCCTTCCACCGTTGCTGACGCTG
CCGAGGCTAGCGCCGTTGGAGCGGCGGCTGACGGGGAGGCCGGCGGTGGACTTGAGCCCCTGGAAAGGAGCGACGGAGGTGGCCGACGAGGCCATCACGG
TGGGGGGCCATGGCTGTGCTATGTAGGTATATAGCTTGCTAGGAGGAGGCACTCTGGC
page-top