Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1512
Contig Information
Length 1683 bp
Tissue Shoot with ABA treatment
Clones 117 Clones [Download: CSV  ,  FASTA ]
whva11b14    whva11j24    whva12j13    whva12p19    whva13d15    whva14a01    whva14e07    whva14f20    whva14i13    whva14n23    whva16a21    whva16a22    whva16f20    whva16j17    whva16k12    whva18a03    whva18c18    whva18e17    whva18j03    whva18j15    whva19a23    whva19d06    whva19p09    whva20c15    whva20d22    whva20h10    whva20h20    whva10b01    whva10m15    whva10n11    whva1c02    whva1f15    whva2a02    whva2e19    whva2j23    whva2k04    whva3b05    whva3i19    whva3j24    whva3l05    whva4m04    whva5a23    whva5a24    whva5c02    whva5f05    whva5g18    whva6o18    whva6p02    whva7d02    whva7e20    whva7k18    whva8g15    whva8h19    whva9b14    whva9b15    whva9d04    whva9f16    whva9f20    whva9m13    whva9m14    whva9n01    rwhva16a21    rwhva16a22    rwhva16e15    rwhva16f20    rwhva16j17    rwhva16k12    rwhva18a03    rwhva18c18    rwhva19a23    rwhva19d06    rwhva19p09    rwhva20c15    rwhva20d22    rwhva20h10    rwhva20h20    rwhva11b01    rwhva11j24    rwhva12j13    rwhva12p19    rwhva13j20    rwhva14e07    rwhva14f20    rwhva14i13    rwhva14n23    rwhva10b02    rwhva10m15    rwhva10n11    rwhva1c02    rwhva1f15    rwhva1l24    rwhva2a02    rwhva2e19    rwhva2j23    rwhva2k04    rwhva3b05    rwhva3i19    rwhva3j24    rwhva4m04    rwhva5a23    rwhva5a24    rwhva5f05    rwhva6b15    rwhva6g02    rwhva6p02    rwhva7a13    rwhva7f18    rwhva7k18    rwhva7m16    rwhva8g15    rwhva8h19    rwhva9b14    rwhva9b15    rwhva9d04    rwhva9f20    rwhva9m13    rwhva9m14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Ribulose bisphosphate carboxylase/oxygenase activase A, chloroplastic; Short=RuBisCO activase A; Short=RA A; Flags: Precursor >gi|167097|gb|AAA63164.1| ribulose 1,5-bisphosphate carboxylase activase isoform 2 [Hordeum vulgare subsp. vulgare]
Score 2201
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1512
ACGAGGCGGTCATTCATCGCTGATCACCAGCACAGCCGCGCATCCACCGTTGCTAGCAAGGTCGACCAAGCAGCACCGAGATGGCTGCTGCCTTCTCCTC
CACCGTCGGTGCCCCGGCTTCTACGCCGACCAACTTCCTCGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCTCCAAG
GCCAACAGGTTCACAGTCATGGCAGCGGAAAACATCGACGAGAAGAGGAACACAGACAAGTGGAAGGGTCTTGCCTACGATATCTCCGACGACCAGCAGG
ACATCACCAGAGGGAAGGGCATCGTGGACTCCCTCTTCCAGGCGCCCACGGGCGACGGCACCCACGAGGCCGTCCTCAGCTCCTACGAGTACGTCAGCCA
GGGACTCAAGAAGTACGACTTCGACAACACCATGGGAGGCTTCTACATCGCTCCTGCTTTCATGGACAAGCTTGTTGTCCATCTCTCCAAGAACTTCATG
ACCCTGCCCAACATCAAGATCCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAGTGTGAGCTTGTCTTCGCCAAGATGGGCA
TCAACCCAATCATGATGAGTGCCGGAGAGCTGGAGAGTGGCAACGCCGGAGAGCCAGCCAAGCTCATCAGGCAGCGGTACCGTGAGGCTGCAGACATGAT
CAAGAAGGGTAAGATGTGCTGCCTCTTCATCAACGATCTTGACGCCGGTGCGGGTCGGATGGGCGGGACCACACAGTACACCGTCAACAACCAGATGGTG
AACGCCACCCTCATGAACATCGCCGATGCCCCCACCAACGTGCAGCTCCCAGGCATGTACAACAAGGAGGAGAACCCTCGTGTGCCCATCGTCGTCACTG
GTAACGATTTCTCAACGTTGTACGCCCCTCTCATCCGTGATGGTCGTATGGAGAAGTTCTACTGGGCTCCCACCCGCGACGACCGTATCGGTGTCTGCAA
GGGTATCTTCCAGACCGACAATGTCAGCGACGAGTCCGTCGTCAAGATCGTCGACACCTTCCCAGGACAATCCATCGACTTTTTCGGTGCTCTGCGTGCT
CGGGTGTACGACGACGAGGTGCGCAAGTGGGTGACCTCTACCGGTATCGAGAACATTGGCAAGAAGCTTGTGAACTCGCGGGACGGACCAGTGACCTTTG
AGCAGCCAAAGATGACAGTCGAGAAGCTGCTAGAGTACGGGCACATGCTCGTCCAGGAGCAGGACAATGTCAAGCGTGTGCAGCTTGCTGACACCTACAT
GAGCCAGGCAGCTCTGGGTGATGCTAACCAGGATGCGATGAAGACTGGTTCCTTCTACGGTTAGAACATTCTCCATACACACCCACCATCTCTTGCTGCA
TAGGAGGAGGTAAAGGGGCACAGCAAGGTACTTTGCCTGTGCCGGCAGGATGCACCGACCAGACTGCCAAGAACTTCGACCCAACGGCGAGGAGTGACGA
CGGCAGCTGCCTTTACACCTTTTAAGCATGCCAATTTAATATCTGATATTTTTATCCTTTGTACCTAAGTACCGCATCGCATCCAAGCGATTGCTGGGCC
ATGTTTTGTTAATATATAAAGATATTGAGTATACCTATTTGGTAAAGACAAATAGAACTGCTTATCATTTGTCAAAAAAAAAA
page-top