Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1511
Contig Information
Length 1734 bp
Tissue Shoot with ABA treatment
Clones 113 Clones [Download: CSV  ,  FASTA ]
whva11d08    whva11k14    whva11l01    whva12d03    whva12e12    whva12f10    whva12g03    whva12j09    whva12o03    whva12o04    whva13e20    whva13e21    whva14c04    whva14d20    whva14i19    whva14n14    whva15o24    whva16c20    whva16l09    whva16o16    whva17b15    whva17k02    whva18h21    whva18j19    whva19g04    whva19k06    whva19n19    whva20d18    whva20f19    whva20j03    whva10c15    whva10h06    whva10m09    whva1b14    whva1e21    whva1f01    whva1f22    whva1f23    whva2p14    whva3d15    whva3n16    whva4k03    whva4m13    whva5m09    whva6b17    whva6d09    whva6d10    whva6l23    whva6o16    whva7m04    whva7m05    whva8g09    whva8j04    whva8k06    whva9e09    whva9k22    whva9o11    rwhva15o24    rwhva15p01    rwhva16c12    rwhva16o16    rwhva17b15    rwhva17k02    rwhva18h21    rwhva19k06    rwhva19l05    rwhva19n19    rwhva20f19    rwhva20j03    rwhva11d08    rwhva11k14    rwhva11l01    rwhva12d03    rwhva12e12    rwhva12f10    rwhva12g03    rwhva12j09    rwhva12o04    rwhva13e20    rwhva13e21    rwhva13n10    rwhva14c04    rwhva14d20    rwhva14i19    rwhva14n14    rwhva10c15    rwhva10h06    rwhva10m09    rwhva1b14    rwhva1e21    rwhva1f22    rwhva1f23    rwhva2p14    rwhva3d15    rwhva3l05    rwhva3n16    rwhva3o24    rwhva4k03    rwhva4m13    rwhva5m09    rwhva6b17    rwhva6d09    rwhva6d10    rwhva6l23    rwhva7k13    rwhva7m04    rwhva7m05    rwhva8g09    rwhva8j04    rwhva8k06    rwhva9e09    rwhva9k22    rwhva9o11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Ribulose bisphosphate carboxylase/oxygenase activase A, chloroplastic; Short=RuBisCO activase A; Short=RA A; Flags: Precursor >gi|167097|gb|AAA63164.1| ribulose 1,5-bisphosphate carboxylase activase isoform 2 [Hordeum vulgare subsp. vulgare]
Score 1050
Evalue 3.36588e-129
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1511
TTCGGCACGAGGGTCATTCATCACCGATCACCAGCACAGGCCGCGCATCCACCGTTTGCTAGCAAGGCTCGACCAAGCAGCACCGCAGATGGCTGCTGCC
TTCTCCTCCACCGATCGGTGCCCCGGCTTCTACGCCGACCAACTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAG
AGCTCCAAGGCCAACAGGTTCACAGTCATGGCAGCGGAAAACCTCGACGAGAAGAGGAACACGGACAAGTGGAAGGGTCTTGCGTACGATATCTCCGACG
ACCAGCAGGACATCACCAGAGGGAAGGGCATCGTGGACTCGCTCTTCCAGGCGCCCACGGGCGACGGCACCCACGAGGCCGTCCTCAGCTCCTACGAGTA
CGTCAGCCAGGGACTCAAGAAGTACGACTTCGACAACACCATGGGAGGCTTCTACATCGCTCCTGCTTTCATGGACAAGCTTGTTGTCCATCTCTCCAAG
AACTTCATGACCCTGCCCAACATCAAGATCCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCATTCCAGTGCGAGCTTGTCTTCGCCA
AGATGGGCATCAACCCAATCATGATGAGTGCCGGAGAGCTGGAGAGTGGCAACGCCGGAGAGCCAGCCAAGCTCATCAGGCAGCGGTACCGTGAGGCTGC
AGACATGATCAAGAAGGGTAAGATGTGCTGCCTCTTCATCAACGATCTTGACGCTGGTGCGGGGTCGGATGGGCGGGACCACACAGTACACCGTCAACAA
CCAGATGGTGAACGCCACCCTCATGAACATCGCCGATGCCCCCACCAACGTGCAGCTCCCAGGCATGTACAACAAGGAGGAGAACCCTCGTGTGCCCATC
GTCGTCACTGGTAACGATTTCTCGACGTTGTACGCCCCTCTGATCCGTGATGGCCGTATGGAGAAGTTCTACTGGGCTCCCACCCGCGACGACCGTATCG
GTGTCTGCAAGGGTATCTTCCAGACCGACAATGTCAGCGACGAGTCCGTCGTCAAGATCGTCGACACCTTCCCAGGACAATCCATCGACTTTTTCGGTGC
TCTGCGTGCTCGGGTGTACGACGACGAGGTGCGCAAGTGGGTGACCTCTACCGGTATCGAGAACATTGGCAAGAGGCTGGTGAACTCGCGGGACGGACCC
GTGACCTTTGAGCAGCCAAAGATGACAGTGGAGAAGCTGCTAGAGTACGGGCACATGCTTGTCCAGGAGCAGGACAATGTCAAGCGTGTGCAGCTTGCTG
ACACCTACATGAGCCAGGCAGCTCTGGGTGATGCTAACCAGGATGCGATGAAGACTGGTTCCTTCTACGGTTAGAACATTCTCCATACACACCCACCATC
TCTTGCTGCATAGGAGGAGGTAAAGGGGCACAGCAAGGTACTTTGCCTGTACCGGCAGGATGCACCGACCAGACTGCCAAGAACTTCGACCCAACGGCGA
GGAGTGACGACGGGAGCTGCCTTTACACCTTTTAAGCATGCCAATTTAATATCTGATGTTTTATCCTTTGTACCTAAGTACCGCATCGCATCCAAGCGAT
TGCTGGGCATGTTTTGTTAATATAAAAAGATATTGAGTATACCTATTTGGTAAAGACAAATAGAACTACTTATCATTTGTCACTCTCTGTATTCATTCCT
TCAGTGGAGACTGCTTCTGCTTTATGCAAACAGA
page-top