Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1510
Contig Information
Length 838 bp
Tissue Shoot with ABA treatment
Clones 104 Clones [Download: CSV  ,  FASTA ]
whva11g16    whva11h03    whva11j23    whva12l15    whva13n23    whva14a12    whva15b15    whva15h03    whva15k18    whva15o17    whva16e18    whva16j18    whva16m07    whva17b10    whva17f03    whva17g15    whva18g06    whva18g18    whva18h05    whva18p16    whva19m03    whva19o03    whva20d23    whva20i07    whva20j16    whva20n03    whva10d06    whva10l13    whva1a22    whva1g09    whva1h08    whva2a13    whva2f01    whva3a20    whva4e15    whva4f05    whva4f06    whva4n12    whva5e17    whva5k16    whva6j17    whva8g22    whva8j18    whva9c22    whva9e08    whva9k04    whva9p12    rwhva15b15    rwhva15h03    rwhva15k18    rwhva15o17    rwhva16e18    rwhva16j18    rwhva16m07    rwhva17b10    rwhva17f03    rwhva17g15    rwhva17i05    rwhva17l24    rwhva18g06    rwhva18g18    rwhva18h05    rwhva18p16    rwhva19m03    rwhva19o03    rwhva19o15    rwhva20d23    rwhva20i07    rwhva20j16    rwhva20n03    rwhva11b21    rwhva11b22    rwhva11g16    rwhva11h03    rwhva11j23    rwhva12l15    rwhva13c01    rwhva13n23    rwhva14a12    rwhva10d06    rwhva10l13    rwhva1a22    rwhva1b09    rwhva1g09    rwhva1h08    rwhva2a13    rwhva2f01    rwhva2n06    rwhva3a20    rwhva4e03    rwhva4e15    rwhva4f05    rwhva4f06    rwhva4n12    rwhva5e17    rwhva5k16    rwhva6j17    rwhva8g22    rwhva8m03    rwhva9c22    rwhva9e08    rwhva9k04    rwhva9m03    rwhva9p12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Secale cereale]
Score 919
Evalue 2.95088e-97
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1510
GGAGATATTTTTCCATTGGTTACCATTAAAACGTATATAGTCGACATATTGTATAATATTATGCGTCCGTGCATATACATAGCCACCGCATAGCATTCAC
ATACGAGCATGCTTTCTCGAGCCATGTTCGTACATGAACATGGCACATACACATATTCTTAGGAACAAATAAGAAAGATAAATGGAGAAGGAAAACCCAA
AGCAATGTCAGAGTTGACAAAACTGCAATGGCACTTTATATATGGCCTGTCGTGAGTGAGCTGTTTAGGCCTTGCCGGACTCCTCGCAGCCCGGTGGCTT
GAAGGCGATGAAGCTGACGCACTGCACCTGACGCATGTTGTCGAATCCGATGATGCGGACATAGGCGTCAGGGTACTCCTTCTTGACCTCCTCCACCTCG
TTGATCACCTGCGTGGCGTCGGTGCATCCGAACATAGGCAGCTTCCACATTGTCCAGTACCGGCCATCGTAGTACCCAGGGGATGCGTTGTGCTCACGGA
AGATGAACCCAACCTTGCTGAACTCGAGGCAAGGCACCCACTTGGAGCGGATCAGGTAGTCGACCTGCTTAAGGAGGGCCTCCGTGCTGAGCGGTGGCAA
GTAGGACAGGGTCTCGAACTTCTTGATGCCCTCGATGGGCCACACCTGCATGCACCTGATCCTTCCACCGTTGCTGACGCTGCCGAGGCTAGCGCCGTTG
GAGCGGCGGCTGACGGGGAGGCCGGCGGTGGACTTGAGCCCCTGGAAAGGAGCGACGGAGGTGGCCGACGAGGCCATCACGGTGGGGGGCCATGGCTGTA
CTATGTAGGTATATAGCTTGCTAGGAGGAGGCCCTCGT
page-top