Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1508
Contig Information
Length 1248 bp
Tissue Shoot with ABA treatment
Clones 62 Clones [Download: CSV  ,  FASTA ]
whva11m11    whva11m23    whva12n11    whva14e08    whva14e13    whva14g20    whva15f03    whva15i17    whva15l08    whva15l19    whva17c13    whva17d20    whva17g02    whva17j04    whva18c03    whva18f24    whva18g24    whva19m24    whva19p16    whva20f11    whva20o03    whva10b22    whva1f12    whva1g21    whva2d05    whva2e15    whva2g09    whva3a10    whva4h16    whva5f07    whva7k03    rwhva15f03    rwhva15i17    rwhva15l08    rwhva15l19    rwhva17c13    rwhva17d20    rwhva17g02    rwhva17j04    rwhva18c03    rwhva18f24    rwhva18g24    rwhva19m24    rwhva19p16    rwhva20f11    rwhva20o03    rwhva11m11    rwhva11m23    rwhva12n11    rwhva14e08    rwhva14e13    rwhva10b22    rwhva10j12    rwhva1f12    rwhva1g21    rwhva2d05    rwhva2e15    rwhva2g09    rwhva3a10    rwhva4h16    rwhva5f07    rwhva7k03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit PS II 10 kDa protein [Phyllostachys pubescens]
Score 483
Evalue 1.97847e-46
Total Hit Count 63
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1508
CCGGGATTTTACAAGCGTCGGACCGTGTTCATCATAAAGCGTTGGCAAGCGCAGACAGACAGAGCTTGAGAGAGCGCGCGCGAGATGGCAGCCTCCATGA
TCACCTCGCCGATTGTGGCGCCGACGAGCGTCCCCTCCCTCTCCCGCCGGGGTTCCTCCTTCGCCGTCGTCTGCAGCGGTGGCAAGAAGATCAAGGTCGA
CAAGCCCCTTGGACTTGGAGGCGGCTTGACAGTCGACATCGACGCCAACGGCAGGAAGGTGGGCAAGAAGGGCGTGTACCAGTTCGTTGACAAGTACGGC
GCCAACGTCGACGGCTACAGCCCAATCTACACGCCAGAGGAATGGTCTGAATCTGGTGACCGCTACGCCGGCGGAACGACCGGGCTTCTTATCTGGGCCG
TCACCCTCGCCGGCCTCCTCGGCGGCGGCGTCCTCCTCGTCTACAACACCAGCGCTCTCGCCGGCTAAGAGAGCATCTACGTGTAACACAGGGCCGGGTC
TCTGCTTGCATGCACGTCTCTGTAATCTACATAGCTACCTCCTGTGAATGTATGCAATCAACGATGCAAAGTAATTGATCCGAACAGATGGTTTATGTGT
ATGTACGTAACGCTGTAACGATATACTTCCTACTTTGGAAACTGTAAAAGGGTGGATTCTTGGAGCCCGTATGCACGCACCCTCTACCATGCATAGGCGC
ATCTGTTCCTAGGTATTTGGGACGCGCCTGACTCGTGTCACAGAGTGCCCAGAAGATTAATATAGTGGCCGCCGGCGGTCGCCACCTCGCTCACTGCCCT
CGATCGAATTGAACCCCCACTCTGCGACTGCCCGATGGAATCAACAGCGAGACTGAGACGGGGAAGAAGAAATTGGGTGTGGGAGAAATGTTGTTGCCGG
TGTCGGATTTGGGGGAGGAGACGAAAAGGAAGTGTAAAGCAGCGTCTCCTGTGGGAGCTCCTATTTGACGCATTTTACGTCAAATTCTGGATCTGCTGCT
TGACAATGAGAGCGGCTAACCAGTCGACCTGACAAGTGTTGCTGACTATAGAGGAGCACATATGTCTAAGGCTGGTCACAATGGGCAGGAACGTAAGCTA
GTAACCTACACAGTTTCCTAGACTATGTTACTACCTCCATAGTGGGAAGGAACATGTATGTAGTGTCATGCAGCGATGTATTTATTAGGATATAGACTCA
TTGTTTCTTGAAGTGTGTAATGTTCCGGTAACTTAAGCTAGTTACCAC
page-top