Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1507
Contig Information
Length 1050 bp
Tissue Shoot with ABA treatment
Clones 61 Clones [Download: CSV  ,  FASTA ]
whva11f22    whva14m15    whva14m16    whva20b14    whva20o07    whva10f17    whva1n06    whva3h10    whva6d08    whva8d15    rwhva16b22    rwhva16h04    rwhva17m08    rwhva19j11    rwhva19m06    rwhva20o07    rwhva11f22    rwhva11h12    rwhva11j20    rwhva12k12    rwhva13a18    rwhva13d24    rwhva13e24    rwhva13g23    rwhva13k11    rwhva14m15    rwhva14m16    rwhva14p03    rwhva14p05    rwhva10c21    rwhva10d16    rwhva10f17    rwhva10g08    rwhva10j09    rwhva10o10    rwhva1b21    rwhva1n06    rwhva2b23    rwhva2p21    rwhva4l09    rwhva4l15    rwhva4l16    rwhva4n10    rwhva5f16    rwhva5h16    rwhva5h17    rwhva5i05    rwhva5j01    rwhva5k01    rwhva5k02    rwhva6d08    rwhva6d19    rwhva6e03    rwhva7a07    rwhva7c13    rwhva7k12    rwhva7o24    rwhva8a06    rwhva8d15    rwhva8n03    rwhva9g11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Ribulose bisphosphate carboxylase/oxygenase activase A, chloroplastic; Short=RuBisCO activase A; Short=RA A; Flags: Precursor >gi|167097|gb|AAA63164.1| ribulose 1,5-bisphosphate carboxylase activase isoform 2 [Hordeum vulgare subsp. vulgare]
Score 1103
Evalue 1.26355e-135
Total Hit Count 160
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1507
TTTTTTAATAAGCTGAAGCTCAAATTAATATTTTTTTGTTCTGTTTGCAACAAAGCAGAAGCAGTCTCCACTGAAGGAATGAATACTGAGAGTGACAAAT
GATAAGTAGTCCTATTTGTCTTTACCAAATAGGTATACTCAATATCTTTATATATTAACAAAACATGCCCAGCAATCGCTTGGATGCGATGCGGTACTTA
GGTACAAAGGATAAAACATCAGATATTAAATTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTCGCCGTTGGGTCGAAGTTCTTGGCA
GTCTGGTCGGTGCATCCTGCCGGTACAGGCAAAGTACCTTGCTGTGCCCCTTTACCTCCTCCTATGCAGCAAGAGATGGTGGGTGTGTATGGAGAATGTT
CTAACCGTAGAAGGTACCAGTCTTCATCGCATCCTGGTTAGCATCACCCAGAGCTGCCTGGCTCATGTAGGTGTCAGCAAGCTGCACACGCTTGACATTG
TCCTGCTCCTGGACGAGCATGTGCCCGTACTCTAGCAGCTTCTCCACTGTCATCTTTGGCTGCTCAAAGGTCACTGGTCCGTCCCGCGAGTTCACCAGCT
TCTTGCCAATGTTCTCGATACCGGTAGAGGTCACCCACTTGCGCACCTCGTCGTCGTACACCCGAGCACGCAGAGCACCGAAAAAGTCGATGGATTGTCC
TGGGAAGGTGTCGACGATCTTGACGACGGACTCGTCGCTGACATTGTCGGTCTGGAAGATACCCTTGCAGACACCGATACGGTCGTCGCGGGTGGGAGCC
CAGTAGAACTTCTCCATACGACCATCACGGATCAGAGGGGCGTACAACGTCGAGAAATCGTTACCAGTGACGACGATGGGCACACGTGGGTTCTCCTCCT
TGTTGTACATGCCTGGGAGCTGCACATTGGTGGGGGCATCGGCGATGTTCATGAGGGTGGCGTTCACCATCTGGTTGTTGACGGTGTACTGTGTGGTCCC
GCCCATCCTACCCGCACCGGCGTCAAGATCGTTGATGAAGAGGCACCTCG
page-top