Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1504
Contig Information
Length 1478 bp
Tissue Shoot with ABA treatment
Clones 54 Clones [Download: CSV  ,  FASTA ]
whva11j02    whva12c20    whva12m16    whva13f14    whva13j02    whva15e11    whva15n07    whva18b05    whva18n12    whva19g13    whva19k10    whva20a10    whva20a21    whva20a22    whva3l20    whva3n22    whva4c14    whva4d01    whva4f03    whva6c08    whva6f12    whva6f23    whva6h07    whva6n13    whva7f16    whva8h07    whva9g22    rwhva15e11    rwhva15n07    rwhva15o09    rwhva18b05    rwhva18n12    rwhva19g13    rwhva19k10    rwhva11j02    rwhva12c20    rwhva12m16    rwhva13f14    rwhva13j07    rwhva13m16    rwhva3a05    rwhva3a11    rwhva3l20    rwhva3n22    rwhva4c14    rwhva4f03    rwhva6c08    rwhva6f12    rwhva6f23    rwhva6h07    rwhva6n13    rwhva7f16    rwhva8h07    rwhva9g22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribulose-1,5-bisphosphate carboxylase/oxygenase small subunit [Triticum aestivum]
Score 814
Evalue 1.03826e-84
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1504
TTTTTTTTTTGAATTAATAACAGCAAGACAATGGTCCGCGTGTTGTATATAATAAATATCACACAGGTTTTGTATATGTGTAGCCGGTTCTAGAATTTAC
ATATGCATGCTCGAGAACCTATGTTCGTACATACATACACAGACCATATAGAATGAAAAATATGCTCTGGTCGTCCAGCAGAGTCGTGGACAAAAGTGAC
GTTCACAAAAGACCTTCATACATAGGCCATTGTTTCAACTCGTAGTTTAGGCCTTGCCAGACTCCTCGCAACCCGGTGGCCTGAAGGCGATGAAGCTGAC
GCACTGCACCTGGCGCAGGTTGTCGAAGCCGATGACGCGGACATAGGCGTCAGGGTACTCCTTCTTGACCTCCTCCACCTCGTTGAGCACCTGTGTGGCG
TCGGTGCACCCGAACATAGGCAGCTTCCACATTGTCCAGTATCGACCGTCATAGTATCCGGGGGAGCTATTGTGCTCACGGAAGACGAAACCAACCTTGC
TGAACTCGAGGCAGGGCACCCACTTGGAGCGGATCAAGTAGTCGACCTGCTTCAGGAGGGCCTCCGTGGAGAGGGGTGGCAGGTAAGACAGGGTCTCGAA
CTTCTTGATGCCCTCAATCGGCCACACCTGCATGCACCTGATCCTTCCGCCGTTGCTGACGCTGCTGAGGCCGGCGCTGCTGGAGCGGCGGCTGATGGGC
AGGCCGGCGGTCGACTTGAGACCCTGGAAGGGTGCGACGGAGGTGGCCGAGGAAGCCATCACAGTGCAATCACTTAGCAAATCTAGCCCATCTCACCATC
TCCAGCTGAGCTCAACACCACTACTACTGCAAACTCAATAGGGATGGCTCGCGGTGCAGCTACTCAGCTCGTGCTGGTCGCCATGGTGGCCGCTATGCTC
CTCGTAGCCTGCGATGCGGCGATATCCTGCGGTCAGGTGACCTCTGCCTTGAGCCCCTGCATCTCCTATGCACGCGGCAATGGCGCCAACCCGCCTGCGG
CCTGCTGCAGCGGCGTCAGGAGTCTGGCCGGTGCAGCCCGGAGCACCGCTGACAAGCAAGCAGCGTGCAAGTGCATCAAGAGCGCTGCTGGTGGGCTCAA
CGCTGGCAAGGCCGCCGGCATCCCTTCAAAGTGCGGCGTCAGCGTCCCCTACGCCATCAGCTCATCTGTGGACTGTTCTAAGATTCGTTGATCGACCACT
TCTTCTCATCATCGCTGCATATAGCTCCAGCGATCTACGCTGAGTACGATTGAGGTCATACACATACATATACATATATATGAATAAGTGCTCTCATATT
ATCTCACTGCGTGACAGCGAGAGGAGTACCTACGTCCGGCCAGCTCTGCATGGCAGGCCACACTGTTGTATTGATGTTTGGTTGTTCCTTCACCCTTTTG
AGAGGACTCATGAGTTTGTTCTTCTTTGTACCGTGTGCACTTTTGATATATGGATCTTACACTAGTAGAAAAAAAAAA
page-top