Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1501
Contig Information
Length 1086 bp
Tissue Shoot with ABA treatment
Clones 47 Clones [Download: CSV  ,  FASTA ]
whva11l20    whva11p07    whva12h14    whva13f24    whva13j03    whva14e11    whva15e14    whva15k07    whva15m17    whva17f07    whva17m15    whva19c03    whva1f07    whva1j14    whva1o20    whva2c07    whva4a08    whva4d10    whva4f18    whva5g20    rwhva15e14    rwhva15k07    rwhva15m17    rwhva15m18    rwhva17f07    rwhva17m15    rwhva19c03    rwhva11l20    rwhva11p07    rwhva12h14    rwhva12l06    rwhva13f24    rwhva13i16    rwhva13j03    rwhva13j04    rwhva13o17    rwhva14e11    rwhva14g23    rwhva1f07    rwhva1j14    rwhva1o20    rwhva2c07    rwhva4a08    rwhva4d10    rwhva4f18    rwhva5g20    rwhva6g20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Carbonic anhydrase, chloroplastic; AltName: Full=Carbonate dehydratase; Flags: Precursor >gi|558499|gb|AAC41656.1| carbonic anhydrase
Score 1055
Evalue 1.85524e-120
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1501
TTTTTTTTTTGAAAGGGTAAACTGTTCATGAAAATATTATTAAACTTATATATGATGTCTTTTGATCACAGGACGATCAAATTATGCATCACATGGTAGT
ACAATTCCTCGTCAGAAAATGGTAAAAGAAAAAGGGTTCTATTGCTTATGGCGAATTCACATCGGGCCATCCCGGCATCCAGTACTGGAAAACAACGAGT
ACGCACTCCATGGCATTGGATTCACATCGGTCGGTCGGACGATATCTTGATATATGTACGCGTTTGCATTCGCATGTATATATAGGAGTTAACCGCTGGG
GAAGATTTACTGCTCCCATGTCTCGAACTTGCCGGAGACGAAGTCGTAATGGCCGCCGACGAGCTTGAGGGTTCCGTTGGACACACCCTCCTTGACGAAC
GGGTAGGTCAGGAGGTTCTGCAGGGACACGTTCACTGCCTCCTTTTCGAGGACGGTGCACTGGTCATCGAAAGGCATGGAGGCGCACTCAGTCTGCACCT
TCTTCTTGGCCGGGAAGCCGATCCTGACCCAGTCCTCGACGAAGTGGAAGGAGTCGTCTGCGCCATCCTTGAGTGAGAGCAGAGCCTTGATTCCACCGCA
GCGGCTGTGGCCAATCACCACGATGACCTCAACCTTGAGAGCACAGACGGCGTATTCGATGGCCGATCCAACACCGGCGTACTTGTTCTTGCAGTAGGAG
GGGACCATGTTGGCGATGTTGCGGATGGTGAAGGCCTCGCCGGGCTCCAGGCCCAGGGTGACCGATGGGCACACACGCGAGTCGGCGCACGCGAACACCA
TGTACTTGGGCGCCTGGCCGGCCTTGAGGGGCTCGAAGAAATCGGGCTTCTTGTCGTAGACCTCGGTCTTGAACTTCTCGAACCCGGTCTTGAGGCGCTC
CACGGCGGCGTCCATCAATGCGGGTGCGACGGGCGCGGCCTGGACGGGGGTGTTCCTGATGACGCTTGGGGCGGAAGGAGGAGGAGTTGGAGGGCGCGGG
GGTGCCGAGGCTGGCGAGCGATGGTGGAGGAGCGGGCACGGGGCGCGACGGTTGCGTAGCACCAGTTAGCCGCGGCGGTCGACATT
page-top