Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1499
Contig Information
Length 795 bp
Tissue Shoot with ABA treatment
Clones 45 Clones [Download: CSV  ,  FASTA ]
whva11o20    whva15a17    whva15k17    whva17a22    whva17e20    whva17n13    whva17n15    whva18e23    whva19l04    whva19l17    whva20h05    whva20n10    whva20o04    whva10g13    whva2a14    whva3k18    whva4c06    whva4o02    whva8c09    whva8c10    whva8c21    rwhva15a17    rwhva15k17    rwhva17a22    rwhva17e20    rwhva17n13    rwhva17n15    rwhva18e23    rwhva19l04    rwhva19l06    rwhva19l17    rwhva20h05    rwhva20n10    rwhva20o04    rwhva11o20    rwhva13e04    rwhva10g13    rwhva2a14    rwhva3k18    rwhva4c06    rwhva4o02    rwhva5f17    rwhva5n14    rwhva8c09    rwhva8c21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Zinc finger CCCH domain-containing protein 19; Short=OsC3H19 >gi|125584263|gb|EAZ25194.1| hypothetical protein OsJ_008677 [Oryza sativa (japonica cultivar-group)]
Score 89
Evalue 0.470136
Total Hit Count 4
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1499
TGATTTCTATATTTATTTATTCTTGTAAAAGTAGATCTTTATTGTAAAGGTTCACATGAAGTACAAAGCACCCCAAACATAATAAACATTACATGAAGGT
AGCTGGCCCACGAACGACCACTGTCCACACCGGAGCCGGCCCGATCTTGTCGATGACAACTGAGAAGTCTTTATGCACACGCCCCTAATGACATGTGCCC
GCTCTGAAGCCGCAGTCATCGCCGTTGAAGCCCATGAACCCGACACCAAATCTCGCCGTCGCACACGCACGACAAGAATACCCTAACCTCACCGCCCCGA
GGAGCTGGCAGGAATCTACGCCGGACAACCACGAAGTTGAGGAGCCCGGGAGACCGTAACCGCAACCACAAGGACCACACATACACGGTGGTTCATAACA
GAAATAGAAAGTGGAAGTACGTAGTATTTATTGTAATACGTAGTATTCTCTTTGCTGCTGCTATACGGTAGGCTCAGTGAGCATGACTTGCAGCAAAGTG
TGGCGCATGGCCATGGGCATCATGCCCCATGTTTCCTCCCGCACACGTGCCTTTCTTGAAGTAGAGGCATGGAGCACCTGCCTTGGCCTTGCCATCGGCC
GCCGATTGCTGAGGAGATTGCTCGTCCACGGCCTGCTTGTTGAGGTCGGTGCTCCGGCGGTCATCACCGGCCGGCGCCTGGAAATCCATCGCCTATTAGC
TCTGCTCAGCTCAGCTCCTCCTCCACCTCCTACTTAGCAAATCTAGCCTCTCACCATCTCCAGCTGAGTTCAACACGATTACTACTGCAAACTCG
page-top