Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1492
Contig Information
Length 1106 bp
Tissue Shoot with ABA treatment
Clones 37 Clones [Download: CSV  ,  FASTA ]
whva12f16    whva14a19    whva14d13    whva15c07    whva15d04    whva15m13    whva16f05    whva17f11    whva18f03    whva19h03    whva19i04    whva19o16    whva5b21    whva6a03    whva7n05    whva8j12    whva8p03    whva9i04    whva9p10    rwhva15d04    rwhva15m13    rwhva16f05    rwhva17f11    rwhva18f03    rwhva19h03    rwhva19i04    rwhva19o16    rwhva12f16    rwhva14a19    rwhva5b21    rwhva6a03    rwhva7n05    rwhva8j12    rwhva8p03    rwhva8p04    rwhva9i04    rwhva9p10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Carbonic anhydrase, chloroplastic; AltName: Full=Carbonate dehydratase; Flags: Precursor >gi|558499|gb|AAC41656.1| carbonic anhydrase
Score 1234
Evalue 1.37574e-133
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1492
ACGAGGCCTCGTGCCGCAATGTCGACCGCCGCGGCTAACTGGTGCTACGCAACCGTAGTCGCGCCCCGTGCCCGCTCCTCCACCATCGTCGCCAGCCTCG
GCACCCCCGCGCCCTCCAACTCCTCCTCCTTCCGCCCCAAGCTCATCAGGAACACCCCCGTCCAGGCCGCCCCCGTCGCACCCGCATTGATGGACGCCGC
CGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCCGATTTCTTCGAGCCCCTCAAGGCCGGCCAGGCGCCCAAG
TACATGGTGTTCGCGTGCGCCGACTCCCGTGTGTGCCCCTCGGTCACCCTGGGCCTGGAGCCCGGCGAGGCCTTCACCATCCGCAACATCGCCAACATGG
TCCCCTCCTACTGCAAGAACAAGTACGCCGGTGTTGGATCGGCCATCGAATACGCCGTCTGTGCTCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAG
CCGCTGCGGTGGAATCAAGGCTCTGCTCTCACTCAAGGATGGCGCAGACGACTCCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGCTTCCCGGCCAAG
AAGAAGGTGCAGACTGAGTGCGCCTCCATGCCTTTCGATGACCAGTGCACCGTCCTCGAAAAGGAGGCAGTGAACGTGTCCCTCCAGAACCTCCTGACCT
ACCCGTTCGTCAAGGAGGGTGTGTCCAACGGAACCCTCAAGCTGGTCGGCGGTCACTACGACTTCGTCTCCGGCAAGTTCGAGACATGGGAGCAGTGAAT
CTTCCCCAGCGGTTAACTCCTATATATACATGCGAATGCAAACGCGTACATATATCAAGATATCGTCCGACCGACCGATGTGAATCCAATGCCATGGAGT
GCGTACTCGTTGTTTTCCAGTACTGGATGCCGGGATGGCCCGATGTGAATTCGCCATAAGCAATAGAACCCTTTTTCTTTTACCATTTTCTGACGAGGAA
TTGTACTACCCGTGTGATGCATAATTTGATCGTCCTGTGATCAAAAGACATCATATATAAGTTTAATAATATTTTCATGAACAGTTTACCCCTTTTAAAA
AAAAAA
page-top