Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1491
Contig Information
Length 1108 bp
Tissue Shoot with ABA treatment
Clones 36 Clones [Download: CSV  ,  FASTA ]
whva13h12    whva14k06    whva15e19    whva15f06    whva15k09    whva15n10    whva18i19    whva20i01    whva10k11    whva2h09    whva3h24    whva3j07    whva4f19    whva4i04    whva4o16    whva4o21    rwhva15e19    rwhva15f06    rwhva15k09    rwhva15n10    rwhva18i19    rwhva20i01    rwhva12k07    rwhva13h12    rwhva13h23    rwhva14k06    rwhva10k11    rwhva3j07    rwhva3j19    rwhva4f19    rwhva4i04    rwhva4i15    rwhva4o16    rwhva4o21    rwhva4o22    rwhva8a13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Carbonic anhydrase, chloroplastic; AltName: Full=Carbonate dehydratase; Flags: Precursor >gi|558499|gb|AAC41656.1| carbonic anhydrase
Score 1241
Evalue 2.12246e-134
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1491
TTTTTTTTTTAAAAGGGTAAACTGTTCATGAAAATATTATTAAACTTATATATGATGTCTTTTGATCACAGGACGATCAAATTATGCATCACATGGTAGT
ACAATTCCTCGTCAGAAAATGGTAAAAGAAAAAAGGTTCTATTGCTTATGGCGAATTCACATCGGGCCATCCCGGCATCCAGTACTGGAAAATAACGAGT
ACGCACTCCATGGCATTGGATTCACATCGGTCGGTCGGACGGTCGGACGATATCTTGATATATGTACGCGTTTGTATTCGCATGTATATATAGGAGTTAA
CCGGTGGGGAAGATTTACTACTCCCATGTCTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCAACGAGCTTGAGGGTTCCGTTGGACACACCCTCCT
TGACGAACGGGTAGGTCAAGAGGTTCTGGAGGGACACGTTCACGGCCTCCTTTTCGAGGACGGTGCACTGGTCATCGAAAGGCATTGAGGCGCACTCAGT
CTGCACCTTCTTCTTGGCCGGGAAGCCGATCCTGACCCAGTCCTCGACGAAGTGGAAGGAGTCGTCTGCGCCATCCTTGAGTGAGAGGAGAGCCTTGATT
CCACCGCAGCGGCTGTGGCCAATCACCACGATGACCTCAACCTTGAGAGCACAGACGGCGTATTCGATGGCCGATCCAACACCAGCGTACTTGTTCTTGC
AGTAGGACGGGACCATGTTGGCGATGTTGCGGATGGTGAAGGCCTCGCCGGGCTCCAGGCCCAGGGTGACCGAGGGGCACACACGGGAGTCGGCACACGC
GAACACCATGTACTTGGGCGCCTGGCCGGCCTTGAGGGGCTCGAAGAAATCGGGCTTCTTGTCGTAGACCTCGGTCTTGAACTTCTCGAACCCGGTCTTG
AGGCGCTCCACGGCGGCGTCCATCAATGCGGGTGCGACGGGCGCGGCCTGGACTGGGGTGTTCCTGATGAGCTTGGGGCGGAAGGAGGAGGAGTTGGAGG
GCGCGGGGGTGCCGAGGCTGGCGACGATGGTGGAGGAGCGGGCACGGGGCGCGACGGTTGCGTAGCACCAGTTAGCCGCGGCGGTCGACATTGCGGCACG
AGGCCTCG
page-top