Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1487
Contig Information
Length 1609 bp
Tissue Shoot with ABA treatment
Clones 29 Clones [Download: CSV  ,  FASTA ]
whva12k11    whva15c16    whva16l08    whva18h08    whva3g17    whva4g11    whva8p18    rwhva15c16    rwhva15e15    rwhva16b08    rwhva16l08    rwhva17e03    rwhva18h08    rwhva12j18    rwhva12k11    rwhva12p01    rwhva13g03    rwhva14b21    rwhva14b22    rwhva2b17    rwhva2p09    rwhva3b09    rwhva3g17    rwhva4g11    rwhva4o18    rwhva6h08    rwhva7c10    rwhva8p16    rwhva8p18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative AdoMet synthase 3 [Hordeum vulgare subsp. vulgare]
Score 1380
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1487
TAGAATTACACATGGCTCTTTATTATTCTTTCCGAGACTCAGGAAGAAAGAGCATTATGAGGGAACTACACAACAAAGAATATGATAAGTGAAAGTGACA
GAGCGACTAACAGAGCAAACTGCACATAGCTCAGCAGTTTCAGCGACTCAAAATGGAAAGGATAAATATATGAAATGACAATAAGAAACTTAGCACTGAC
TACCATACAACAAGACCAGTGTAGAGCGTCGCTTCAATATCTAATGCTTCTTCCCACTTCCCAGGAGCAACATGATCCCGTCTTGACGAACTTGAGAGGC
GGCAGACCAAGAGAATGCCATGCTCTTAGGCAGATGCCTTGTCGAACTTGAGGGGCTTCACCACCTCCCAGGTGAAGTCGGCATCATCACGGCCAAAGTG
ACCGTAAGCAGCGGTCTTGATGAACCTGTTTCCACCTTTCTTCAAGTCCAGGTTGATGCTGATCATCCCGGGCCTGAAGTCAAAGTTCTCCTTCACGAGC
TTGAGGATCTCCCTGTCGGGGATCTTGCCGGTGCCGTAGGAGTCGACGAACACAGACAAAGGCTCAGGCACACCGATGGCGTATGAGATCTGCACAATGC
AGCGGCGTGCGAGGCCGCTGGCGATGATGCTCTTGGCGGCCTGCCTGGCAATGTAGGCGCCACTGCGGTCGACCTTGGTTGGGTCCTTGCCAGAGAAGGC
ACCGCCGCCGTGGGCTCCCCAGCCCACCATAGGTGTCGATGATGATCTTGCGGCCGGTGAGACCGGCGTCACCATGGGGGCCGCCGATGACGAAGCGGCC
AGACGGGTTCAGGTGGAAGATGGTGTTCTCATCGAGGTACTTTGCGGGGATCACCGGCTTGATGACATGCTCCTTGAGGTCCGCAGCAATCTCGTCGTTG
GTGACGGTCTCGTCGTGCTGGGTGGAGATGAGGACGGTGTGCACACGAACAGGTACCATGGCACCATCCTCGTTTAGGTACTCGACTGTGACCTGGGTCT
TTCCGTCAGGCCTGACCCAGGCGCAGGTGCCATTCTTGCGGACCTCGGTGAGGCGAGCTCCGAGCTTGGTGGCAAGCACGTGGCTGAGGGGCATCAGCTC
AGGGGTCTCGTCGGTGGCATAGCCGAACATGATGCCCTGGTCACCGGCGCCAACCTCTTCAGGACGCTTGGTGAAGTGTCCGTGAACACCCTGGGCAATG
TCAGGGGACTGCTGCTCGATGTTGACGAGCACCTTGCAACGGTCGGCGTCGAGACCAACGTCATCAGAGATGAAACCGATGTTGCGGCAGGTGTCGCGCA
CGATCTTCTCATAGTCGACGGTGGCCTTGGTGGTGATCTCGCCCAAGACCATGACCATGTTGGTCTTGGTGACGGTCTCGCAGGCGACCTTGCTGTCGGC
ATCCTGGGCCAAGCAGGCATCCAAGACGGCGTCGGAGACCTGGTCACAGAGCTTGTCGGGATGGCCCTCGTTCACAGACTCGGACGTGAAGAGGAACGTC
TCGGCCGCCATTTCTTTAGTGCTAGCGGTGCTCTTGCGCTGCTTCTACTGCTCGATCGGGAGGCCGATGAACCGAGGGAGGGAAGAGGCGGAATGTCCTC
GTGCCGAAT
page-top