Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1486
Contig Information
Length 790 bp
Tissue Shoot with ABA treatment
Clones 28 Clones [Download: CSV  ,  FASTA ]
whva12f24    whva14m14    whva14n01    whva15b23    whva15d21    whva15h19    whva16c08    whva16o07    whva20g07    whva20g08    whva20g19    whva20g20    whva10l22    whva7i24    rwhva15b23    rwhva15d21    rwhva15h19    rwhva16c08    rwhva16o07    rwhva20g08    rwhva20g19    rwhva20g20    rwhva12f24    rwhva14m14    rwhva14n01    rwhva14n02    rwhva7d20    rwhva7i24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit chopper chaperone [Hordeum vulgare subsp. vulgare]
Score 346
Evalue 7.38019e-31
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1486
GGTGCAGGCATCATCAAACTCTCCCTCCGACGACATCGATCCCCGTCTCCCGATCTTCTCCTCCTGACTCCTGCTGTAGCTGCCAGCCATGGCCTCCGAG
ACTGTTGTCCTCAAGGTGGCAATGTCCTGCGGAGGTTGCTCGGGGGCGGTTAAAAGGGTGCTCACCAAAATGGAAGGCGTCGAGAGCTTCGACATAGACA
TGGAGCAGCAGAAGGTGACCGTGAAGGGCAACGTCAAGCCAGAAGACGTTTTCCAGACGGTCTCCAAGACCGGGAAGAAGACCGCCTTCTGGGAGGCCGA
AGCCACTCCTGTACCGGAGGCTACCCCGGCAGCCGACGCCGTGCCTGCACCTGAGGCAACCCCGGCAGCAGACGCCGCGCCTGCACCGGAGGTGACCCCG
GCCAACACCGTCGCTTGATGACCACGCACAGATGATGCCGCCGTGACCTTTGAAAACTCCAAGATATTGTTGTTGAGAGAGTCATGGCGGTTTGCACGAT
GTTACTTACGAGTTGACTACAACGTAATGGAATAAACAAAGTGTGTATGATCTAGACAAATGAACACGTCGACCACATGATTTACAATAGATTTCAGTTC
TATTAATGTTCTACAGCTCTTCCGTTGACGAAAGTGTTCAGTACAGCCGTCCATGTTAAATTTACACAAAAATGAAATTTTTAGCACAAAGATACAATGT
TGTATTAAGGCCTGCTTACTGCAAAAAATTGTGGGACCATGTTATGTTTGGCACTTGCTTGAGACTGCTCGGGTTTGGAGAAAAAAAAAA
page-top