Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1485
Contig Information
Length 870 bp
Tissue Shoot with ABA treatment
Clones 28 Clones [Download: CSV  ,  FASTA ]
whva11f10    whva11f21    whva12b11    whva15e24    whva15h12    whva15m02    whva15p02    whva16i16    whva16j03    whva18l01    whva19h16    whva20o23    whva5g07    rwhva15e24    rwhva15h12    rwhva15h24    rwhva15m02    rwhva15p02    rwhva16i16    rwhva16j03    rwhva18l01    rwhva19h16    rwhva20o23    rwhva11f10    rwhva11f21    rwhva12b11    rwhva3p21    rwhva5g07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Cytochrome b6-f complex iron-sulfur subunit, chloroplastic; AltName: Full=Rieske iron-sulfur protein; Short=RISP; Short=ISP; AltName: Full=Plastohydroquinone:plastocyanin oxidoreductase iron-sulfur protein; Flags: Precursor >gi|32394644|gb|AAM88439.1| putative Rieske Fe-S precursor protein [Triticum aestivum]
Score 1111
Evalue 1.70997e-119
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1485
TTTCTCTTCTTCCATAGACTGTATACATATAACTGGATACAAGAAACAGGTGCATTTATAGCAGGAGTAGTCTTATAGCAGCGCTTCTTAGGACTGGCAG
GAGGCTTAACATATCACACGAGTGAGCATTGCTGCCGGAGCTTGCGTCGCTTATTTCCACCACGGGTTGTCGCCGGTCCTGAAGTCGGTCTCCACCCACG
GCACGAAGACGACCTTGCCGTCGTCGACGTCGGCGTGAACAAGGGCCAGCGACAGAGGTGCAGGCCCACGGACAACCTTGCCCTGGTTGTTGTACTGGGA
TCCATGGCAGGGGCAGAGGAACTTGTTCTCGGCGGCGTTCCACGGCACGACGCATCCAAGATGCGTGCACACGGCGTTGATCCCGTAGGTGGCGAGGGTC
TTGTCGGACTCCACCACAAGGTAGGTAGGATCACCCTTGAGCCCCTGGGCGAGCGTGCGGTCGTTGGGGCCGTGCGTCTTGAGCCAGTCCTCGACGAGGA
TGTCGTTGCCGAGCTTGTCCTTGGCGGCGACCCCTCCGGCGTTGCTCCCGGAGCCGGCCGGGACGAGGAAGGAACCGTAGGGGACGAGCATGCCGAAGGT
GGGGAGCGAGATGGCGCCCAGCAGGAGCAGGTTCATCAGCTCCCTCTTGCTCATGTCCGGCACGCGGTCCGCGGAGATGCTGCCGGCCATGCAGGTGATG
TTCCTCGGGACGCGCTCCCGGCTGAAGCCCAGGCCCTTGACGGGCTTGCACAGCGAGCTTGCGCGGGTCCGGCAGAGCTGGGTAGGGTTGGAGGCGGTGG
AGAGCGCGGTGGAGGCCATGGCGACTGGCTGCGTCACGGCGGAGAGGACGATCGAGCGAGCGAGCGAGCT
page-top