Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1470
Contig Information
Length 788 bp
Tissue Shoot with ABA treatment
Clones 19 Clones [Download: CSV  ,  FASTA ]
whva11d12    whva11d23    whva11j04    whva17h11    whva10j15    whva1h15    whva4i16    whva5e18    whva8h13    whva8h14    rwhva17h11    rwhva11d12    rwhva11d23    rwhva11j04    rwhva10j15    rwhva4i16    rwhva5e18    rwhva8h13    rwhva9h13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Ribulose bisphosphate carboxylase small chain PWS4.3, chloroplastic; Short=RuBisCO small subunit PWS4.3; Flags: Precursor >gi|170769|gb|AAA34301.1| ribulose-1,5-bisphosphate carboxylase/oxygenase
Score 800
Evalue 1.66123e-83
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1470
TCGGCACGAGGGTTCTCTCTCCGGCATCCTCCTCTCCTCCGATAATACAATACCATGGCCCCCGCCGTGATGGCTTCGTCGGCTACCACCGTCGCACCCT
TCCAGGGGCTCAAGTCCACAGCCAGTCTGCCCGTCAGCCGCCGCTCCAGCGGCAGCCTCGGCCGCGTCAGCAATGGCGGAAGGATCAGGTGCATGCAGGT
GTGGCCGATTGAGGGTATCAAGAAGTTTGAGACCCTGTCTTACTTGCCACCCCTCTCCACAGAGGCCCTCCTAAAGCAGGTAGACTACCTGATCCGCTCC
AAGTGGGTGCCCTGCCTCGAGTTCAGCAAGGTTGGCTTCGTCTTCCGTGAGCACAACAGCTCTCCCGGGTACTACGACGGTCGATACTGGACAATGTGGA
AGCTGCCTATGTTCGGGTGCACCGACGCCACGCAGGTGCTCAACGAGGTGGAGGAGGTCAAGAAGGAGTACCCTGATGCCTATGTCCGTGTCATCGGCTT
CGACAACCTGCGCCAGGTGCAGTGCGTCAGCTTCATCGCCTTCAGGCCACCAGGTTGCGAGGAGTCCGGCAAGGCCTAAACTACAAGTTGAAACAATGGC
CTATGTATGATGGTCATTTGTGAACTTCACTTTTGTCCACGACTCTGCTTTCCGACCAGAGCATATTTCTCGTTCCATATGATCTGTGTTTGTACGAACA
TAGGTTGTGGAGCATGCATATGTAAATTCTAGCGAAAAATCTATACTGAAGTCGAGAGGGGCTCGGGGCTCCGCTGCTAAAAAAAAAA
page-top