Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1465
Contig Information
Length 760 bp
Tissue Shoot with ABA treatment
Clones 18 Clones [Download: CSV  ,  FASTA ]
whva12c11    whva13n06    whva15g04    whva16g11    whva16g12    whva16j22    whva10c01    whva6l14    rwhva15g04    rwhva16g11    rwhva16g12    rwhva16j22    rwhva12c11    rwhva13m18    rwhva13n05    rwhva13n06    rwhva10c01    rwhva6l14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit type 1 non specific lipid transfer protein precursor [Triticum aestivum]
Score 382
Evalue 4.56187e-35
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1465
TTTTTTTTTTATCAAAAGTGCTGAATAACATGCGCACGCAAGTACAGCTGATCAGCTGTGTATACAATCCATATATCAAAAGTACACATGGTACAAAGTA
CAGCAACCCTCGGGGAGTGGAGGAACAACCAAACATCGATATAACAGTGTGGCCGGCCATGCAGAGCTGCTTGGACAGTGTGTCTCTCTCTCACGCAGTG
AGATAATATGAGAGCATTTATTCATATATATGTGTGTGTGTGCGTGTGTGTGACCTCAACGTACTAAGCGTAGATCCAGCAACGATGGCGTAGGGGACGT
ACGATAGCAACAACGATGGCAGCAAGTGCTCGATCAGTGAATCTTAGAGCAGTCGACCGAAGAGCTGATGGCGTAGGGGACGCTAACGCCGCACTTTGTG
GGGATGCCGGCGGCCTTGCCAGCATTGAGCCCAGCAGCAGCGCTCTTGATGCACTTGCACACCGCTTGCTTGTCAGCGGTGCTCCGGGCTGAGCTGGCTA
GACTCCTAACGCCGCTGCAGCAGGCCGCAGATGGGCTGGCGCCGTTGCCGCGTGCATAGGAGATGCAGGGGCTCAAGGCAGAGCTCACCTGACCGCACGA
TACGGCCGCCTCCGTGACTGCGAGGAGCATAGCGGCCACCACGGCGACGAGCACGACCTGAGCAACAGCAGAACGGGCCATCTCGATCAAGCTAGCAATA
GTAGTGGTAGTGAGCTCAGGCAGAGATGATGAGATAGCTAGATTTCGGCACGAGGCCTCG
page-top