Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig45
Contig Information
Length 500 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
whfl52c06    rwhfl52c06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein CX157 [Homo sapiens]
Score 583
Evalue 8.0983e-59
Total Hit Count 112
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig45
ggagagagaaactccggagaagaagcaggagcgggtgcggcggcgaggtcgatgtcgacgacggcggggtacctggcgcggcgcgcggggcagaaggagc
gggtgcggctgctctaccgccgcgcgctcaaggacaccctcaactgggccgtccaccgccacctcttctaccaGGACGCGTCCGAGCTCAGGGACAAgtt
cgaGGCCAACAGAAATGTGGAGAACCTGGACGTGATCGATAGGCTCATCGAGGACGCGGAGGCGCAGCAGAGGAACTTCCAGCACCCGGATCCTTACATT
GTTCCATGGGCTCCTGGTGGCACTAAATTCACAAGGAACCCTCCTCCacctgAAGGGATTGAGATTATCTAcaactaTGGCAAagaagaccaatgaacaa
gaatcatgcatttgtgagcagagcctggcaccggcggagtgcaaagganttacttttgcttttccagatgatagcatncanntgagctgctgtattgtta
page-top