Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1458
Contig Information
Length 912 bp
Tissue Shoot with ABA treatment
Clones 17 Clones [Download: CSV  ,  FASTA ]
whva11a13    whva15l15    whva15m20    whva18g11    whva4m12    whva9c21    whva9h22    rwhva15l15    rwhva15m20    rwhva18g11    rwhva18g12    rwhva11a13    rwhva13e13    rwhva10b09    rwhva4m12    rwhva9c21    rwhva9h22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative glycine decarboxylase subunit [Triticum aestivum]
Score 781
Evalue 3.43558e-81
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1458
TTTTTTTTTTAGAGTAGTTATATGATGATTTGTTTGGTGGATGATAATGTCTCTTTTTACCAACAAACTAACATACAAACTCTTTCCCATATCTCTGATG
TCACGGTCACTGAAATGGTATAACAAACTGCTGGACGCCATGTACACCGACAAAAGAAAATTGGAACCGATGAACTGAACGCATGGTGAAGTTGGTGTAA
TTATTGTAGACAAGAGTAGTCGATATGGTTGCAACAAAAAGGAATGATAAGCGAGCAAGGAGCACTAGTGGGCGTCCTCCTCCTCGCAGTGCTTGGTGTA
CTTGGCCGAGTCCAGCAGGCCCTCCAGCTCCGCCGGGCTGCTTGGCTTCACCTTGATCATCCACCCATCCTCGTACGGGCTCGAGTTGATCAGGCCGGGG
GTCTCGGACAGCTTTGAGTTGACGTCGACGACCTCGCCGGAGATGGGCGAGTTGACGTCGCTGGTGGCCTTCACACTCTCCACGTTGCCGAAGGCTCCGC
CCTGGCTCACCTTCGTGCCTGCCTCCGGCAGCTCCACGAACACCACCTCCCCGAGATGGCCCTGGGCGTGGTCACTGATGCCAATCGTGGCCACGGAGCC
GTCGTTCTTGACCCACTCGTGGGAGGAAGTGTACTTCAAGCCATCAATAACGGTGGAGAAGTATCTGGAGATCGAATAAGCCGGGGCAGCAGCCCTGGCG
CCGCTGCTTGAAATCTTGAGGGCATTGGCAGCTGAGCTTGCCCACAGCCTAAGAGCCATTGTAGCCTAATTTGGCTGTTGCAACCTGAAGCAACAAAGTG
AATGTGTGTTCTTTGCCCTCTCCTTGTAGGGGATGGTGCTCGGTGGTAGTAGTGGAAAGAGGCCGTGGGAGGATAGGGAAATGTGGATTGTTTGGCTCAG
CCTCGTGCCGAA
page-top