Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1451
Contig Information
Length 813 bp
Tissue Shoot with ABA treatment
Clones 15 Clones [Download: CSV  ,  FASTA ]
whva11c17    whva11h24    whva11m10    whva10a02    whva3p07    whva6e24    whva9f07    rwhva11c17    rwhva11h24    rwhva10a02    rwhva10a13    rwhva3p07    rwhva7c12    rwhva7c23    rwhva9f07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative glycine decarboxylase subunit [Triticum aestivum]
Score 787
Evalue 5.64614e-82
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1451
TATTAGAGTAGTTACATGATGATCTGTTGGTGGATGATAATGTCTGTTTTTACCAACAAACTAACATACAAACTCTTCCCCATATATCTGATGTCACGGT
CACTGAAATGGTATAACAAACTGCTGGACGCCATGTACAACGACAAAAGAAAACTGGAACCGATGAACTGAACGCATGGTGAAGCTGGTTTAATTATTGT
AGACAAGAGTAGTCGACATGGTTGCAACAAAAAAGGAACGATAATCGAGCAAGGAGCACTAGTGGGCGTCCTCCTCCTCGCAGTGCTTGGTGTACTTGGC
CGAGTCCAGCAGGCCCTCCAGCTCCGCCGGGCTGCTCGGCTTCACCTTGATCATCCACCCCTCCTCGTACGGGCTCGAGTTGATAAGGCCGGGGGTCTCG
GACAGCTTTGAGTTGACCTCGACGACCTCGCCGGAGATGGGCGAGTTGACGTCGCTGGTGGCCTTCACACTCTCCACGTTGCCGAAGGCTCCGCCCTGGC
TCACCTTCGTGCCGGCCTCCGGCAGCTCCACGAACACCACCTCCCCGAGATGGCCCTGGGCGTGGTCACTGATGCCAATCGTGGCCACGGAGCCGTCGTT
CTTGACCCACTCGTGGGAGGAAGTGTACTTCAAGCCATCAATAACAGTGGAGAAGTATCTGGAGATCGAATAGGCCGGGGCAGCAGCCCTGGCGCCGCTG
CTTGAAATCTTGAGGGCATTGGCAGCTGAGCTCGCCCACAGCCTCAGAGCCATTGTAGCCTAATTTAGGTGTTGCAACCTGAAGCAACAAAGTGAATGTG
TGTTCTCTGCTCT
page-top