Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1449
Contig Information
Length 1317 bp
Tissue Shoot with ABA treatment
Clones 14 Clones [Download: CSV  ,  FASTA ]
whva11g22    whva12d02    whva18m22    whva2e09    whva2j17    whva3b14    whva4d23    rwhva18m22    rwhva11g22    rwhva12d02    rwhva2e09    rwhva2j17    rwhva3b14    rwhva4d23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0847700 [Oryza sativa (japonica cultivar-group)] >gi|113534330|dbj|BAF06713.1| Os01g0847700 [Oryza sativa (japonica cultivar-group)]
Score 815
Evalue 1.27442e-147
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1449
GCTTTATTATCATGTGTGGAGCAACTTCTTTGGAGGAACACAATTACACCAGCAAACCAACAATCGGTACAGAACAGGTGATCCCAGTCGCAGGAACAAG
CTAGGATAAGTTCATGCCTCCATTGGCAACACGCGGGTTTAGCAGAAAATCCATACCTAAAGGGGCAAATCCATGCAGTCTACTGAAGAGTTCCTCCCAC
AGTGGGGCTAAACCACCATACATCTCTTAAGCTTACAGTTTGACGATACATAACAAGTGACTGACACTAGTAAGGCGCCCTGCTCCCAGCCACGACAGGA
GCCGTCCTAGATTTCGCCGTCCCAGAGCTCATCGTGGGTCTTGTAAACGCTGTCTTTGTTGACGATGAAGTTGCCCATGAGAAGCCTGGCCTGCTTAATC
TCAGAGAACTTTGCAAGCAAGTCTTCTGGAATAGACCAGTCATAAACAGCAAGGTTCTGCTTTATCCGTTCTTCACTCACGCTCTTTGGCAGTACACTGT
GACCCATCTGAATGTTCCAGCGCAACGCCACTTGTGCAGGAGTTTTGCCAAGCTTCTCTGCAATTGAGAGGACGACGGGTTCTTTGAGGACATTACCATT
CATCCATGTTGAACCAGGCGAACCTAGTGGTGAGTACGCAGAGAGGTGAACACCGGCCGACTGACAAAAGGTATGGAGTTTAGATTGCTGCCAACCAGGA
TGGCACTCCACCTGGTCAACAGCCGGAGGTATGCGAGCTACAGCAAGCAAGTCACCCAATTTCTTCGACGCGAAGTTACTCACACCAATTGCACGAGCTT
TGCCAGCATCATGTAACTTCTCCATTGCTCCCCCATGTAGCTGGGATGTCAGGTGGTAAGAAGTTTTCAGGGTTGCCAATGCTTGTTCCCTTCCTGACTC
TAAATGGCCAATGGATAAGGTAAAGATCCAAGTAGTCAAGCTGCAAGTCATCGAGAGAATCCCCAAGTGCCTCAGGCACATCTTCTGGGGCATGATGACC
ACACCATAGCTTAGAGGTGATAAACAGATCCTCACGCTTGACTACACTCTCTTCAAACAGCTTCTTCAGAGCCAAACCCACCTCCTTCTCGTTGTTGTAG
GCCCTGGCGCAGTCGATGTGCCGGTACCCCGCCTTGACGGCGGCGTAGACGGCCTCGCCGACGATGCCGGGGTCGGACTGCCAGGTGCCGAGCCCCACGG
AGGGGATCTTGGCGCCGGTGTTGAGCACGAAGTGCGTCGCCATCCCCGCTCCCAGACACCACCCGCACACGGAGGCAGTCACTTGCAGTCTCTCGCAGAC
GACGCTCGAAGGAAGGG
page-top