Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1448
Contig Information
Length 1489 bp
Tissue Shoot with ABA treatment
Clones 14 Clones [Download: CSV  ,  FASTA ]
whva11f24    whva13o08    whva19j18    whva10a18    whva3i13    whva5k24    whva7a18    rwhva19j18    rwhva11f24    rwhva13o08    rwhva3i13    rwhva5k24    rwhva7a18    rwhva7m12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0208000 [Oryza sativa (japonica cultivar-group)] >gi|53749331|gb|AAU90190.1| putative 2-oxoglutarate/malate translocator [Oryza sativa (japonica cultivar-group)] >gi|113578455|dbj|BAF16818.1| Os05g0208000 [Oryza sativa (japonica cultivar-group)] >gi|125551229|gb|EAY96938.1| hypothetical protein OsI_18855 [Oryza sativa Indica Group] >gi|215701101|dbj|BAG92525.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765355|dbj|BAG87052.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1269
Evalue 1.82361e-137
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1448
GTATGTGACATGCCAAGAAAAATACAACAACAACGAGAATTGACTACACATTTTACCCCGCCAAAAAATACATGTCGACACTTGACAAACATAAGGCCTA
AACAAATATATACTGAAAAAGGTTGTTTGATGTCCGGCTCCATTGATGAGATGGGTTCAATCCGGTGGTGGCATATCCGCTCCTAACAACTCTACTTTCA
GCCAAGAGTTACCCAGAAATGATATGATTATTTGGTCTGAAAGACACAAAGAACAATGGTAGCATATAGGCCAAGGAGATAAGTACAGATTTTGTTTATC
AGAAGCAACTGCTGGTTTATAGGTACAAAGCAGCTACACTATTATAATTTGTCGGCAAGGATAGCATAGCACAGCACTTTAAAGGCCGACACGCTTCTCG
ACCTTCTGAATCTGATTCAAGAATATCCAAGTCATCATGACATGTGGAGCAATCCTGACACAGTAGACCGGAAAGCCAGTGTAGAACTTAAATGGACCAC
CACTCTTCAAGGTCTTCATTGCACAGTCAAGAGACCCAGTGTATGGATACTTTCCAGTAGCATCAGGTTGCATCTTCTGAACCTGTGTCTTAACATAGTC
GAAGGGCAAACTGCAAGCAGACGCGAAGAATCCTGAAACAGCACTGGCCCCAAGCATTGTAGAAAGTTCACCAGCACCAAGTTTGTCTCTAAGTACCTCA
ACACTCTGATCATAGGAGGCAAGCATGCCCATGTTTAGTGACATCGCTCTAGCTACAGTTGGACCTGCGCCCTTCCAAAGTGCCAGAACACCTTCATCAG
CAATAATACGGTAAAGTGCATGAAAAGCATTCTTATAGTGGCGGCGCTGGGCTGCTGGCAAGGTTGAATCAGCCTGCATCCTAATGAGTGCCAAATCTGC
AGGACTACCAAAACACGCTCCAATCGCTCCAGCAGTGAGACCAATAGCAGCCTTCTGGACTAAGGGCAGTGGTTTTCCTTCGTTTGCTTCAACTGCTTTA
TTTGTTAGAACCCTGAAGGATCCAAGTCGAGCGGTTGTGTATGTCGCTTGCCTTAGCAAGCCAGCAGATAATCCCTTGTAAAAGGAACCAACTCCCTCAT
TAGCAAGCATCTTCTTGGTGACAGAAGTTGCAGAGCCCTCGCCCAACTGGATCTTCACCTTGACCATGTCGATGGGCTGGATGACGCAGGTGGCGAGCAT
GCCGGAGGCGCCGCCGTTCACGAAGGGCTTCACCGTCTTCCAGACGCCGCTGGCCGCCAACGCCGTCTGCGGCGGCTGCTGCTGCTGCTTCGCATCCGCC
ATCTCCTCCGCCTCGTATCAACTCCCACCGATCCTGAGCCAGGAGGAGCTCCCGCGCTGCTGCCTGGGCTTCCGGAGAAGCAGAGGTGGTGGGAAGCAGA
GGACTGTGAGGCGACGGGGACGTGTGGTATCGCGGCTGGATACCTCGGCGTGAGCCACGAGCCCACGGGCAATTTCCCCTCGTCCGAAT
page-top