Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1446
Contig Information
Length 1163 bp
Tissue Shoot with ABA treatment
Clones 14 Clones [Download: CSV  ,  FASTA ]
whva12c07    whva15e05    whva16b14    whva16m19    whva17a01    whva17a02    whva17b21    rwhva15e05    rwhva16b14    rwhva16m19    rwhva17a13    rwhva17a14    rwhva17b21    rwhva12c07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Phosphoglycerate kinase, chloroplastic; Flags: Precursor >gi|21833|emb|CAA33303.1| unnamed protein product [Triticum aestivum] >gi|3293043|emb|CAA51931.1| phosphoglycerate kinase [Triticum aestivum]
Score 1568
Evalue 2.75033e-172
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1446
TTGGCTCCCCTTGTGCCACGATTATCCGAGCTTCTTGGCATTGAGGTGAAAAAAGCAGAAGATGTTATCGGCCCAGAAGTTGAAAAATTGGTGGCTGACC
TGGCAAATGGTGCTGTTTTGCTCCTGGAAAACGTAAGATTTTACAAGGAAGAGGAGAAGAATGACCCAGAGTTTGCAAAGAAGCTTGCTTCACTGGCAGA
TCTGTTTGTAAACGATGCATTCGGAACAGCCCACAGAGCACATGCCTCGACTGAGGGAGTTACCAAGTTCTTGAAGCCTTCTGTTGCTGGATTCCTTTTG
CAGAAGGAACTTGACTACCTGGATGGAGCTGTTTCAAACCCTAAGCGCCCATTCGCTGCCATTGTGGGTGGCTCAAAGGTGTCGTCCAAGATTGGGGTTA
TCGAATCCCTGTTGGAGAAGTGTGATATCCTTCTTTTGGGTGGTGGTATGATCTTCACATTTTACAAGGCACAAGGACTCTCAGTTGGTTCTTCCTTGGT
TGAGGAAGATAAACTTGAGCTGGCAACATCTCTCCTTGCAAAGGCAAAGGCAAAGGGTGTCTCCCTTCTGTTGCCATCTGACGTTATCATTGCTGATAAG
TTTGCTCCTGATGCTAACAGTCAGACCGTCCCTGCATCTGCAATTCCTGATGGTTGGATGGGGCTGGACATTGGCCCAGATTCAGTCAAAACATTTAATG
ATGCCCTGGACACAACACAGACAATCATTTGGAACGGACCAATGGGTGTCTTTGAATTTGACAAGTTTGCAGTAGGAACTGAGTCTATTGCAAAGAAGTT
GGCCGAGCTTAGCAAAAAGGGCGTTACAACTATCATTGGAGGCGGAGACTCCGTTGCGGCTGTTGAGAAGGTGGGAGTGGCTGATGTTATGAGCCACATC
TCAACTGGTGGTGGCGCCAGCTTGGAGTTGTTGGAAGGAAAGGAGCTTCCTGGAGTCGTTGCACTTGATGAAGGTGTCATGACGAGGTCGGTGACCGTAT
GAGGCTAAGCTTCATTTGTTGCATCTTAATTCCTTTCATGTACCGTTCCAAACCTGCCATGTTGTCCTCCCTCTTTTGCTCGTCTTCGACCACTCGAAAT
GTAAGAGACCAATGTTTTATAGAGAAATACTGGGAACTGTTTGAATAACACCCAAAAAAAAAA
page-top