Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1442
Contig Information
Length 932 bp
Tissue Shoot with ABA treatment
Clones 14 Clones [Download: CSV  ,  FASTA ]
whva11d15    whva11d16    whva20n08    whva20n19    whva5e02    whva8m23    rwhva19g20    rwhva20n08    rwhva20n19    rwhva11d15    rwhva11d16    rwhva5e02    rwhva6e02    rwhva8m23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_13431 [Oryza sativa Indica Group] >gi|125587845|gb|EAZ28509.1| hypothetical protein OsJ_011992 [Oryza sativa (japonica cultivar-group)]
Score 942
Evalue 7.62162e-100
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1442
TATCCTTTCCGGGTCACTCCCAAGCTTTATTCTGCGTCTATCACCATCAGCTGAGATGGATGGTCTATACGCTCCAGAAACAAGCACGCGGCGGCGCGCG
GCCACGGAAATATGCACTAAATAAGCAGGAAAACATCACACACGCAAATTCAAGTTCAACAGCCATTGTCCGCGAAGAAACACGGCCTATTTCGTCATCA
TCACCCTGGTCGTTATTGTAGAGTTCACTCAAAGGGACGCCCTGCAAAACGGCTGGGTCCTAGTACCCACCCTGGATGTAGGCGTTGAGCCGGTTCAGCT
CCTCCTTGTGCTCGCTGACCACCGCGCGAACCACGTCGCCGATGGAGACCATCCCCATCATCTCCGTGCCGCTGATCACCGGGATGTGCCTGATACGCTT
TTCTGTCATCAGCTGCATTGCTTTCAGGACTCTGGTTTCAGGTTTCACCGTGATCAGCTTGTTCTCTTCGGTCATGATATCTCCAACTTTGGTTGACTTG
GAGGATCGACCCTGCACTATAATTTTCCGGAGATAATCTCTCTCTGTGACGATGCCCGCAATTGATTTATCTTCCCCAGGTTTAACAACCACCAAAGCTC
CCACATTGTGCTGTGTCATCGATTTGACAGCATCATAGACACTATCATCAGTGGTGCACCAGAGCCATGATCCATCGGCACTCTTCCCTTTAGACTTCAA
AATGTCTGCAACAGTGCTGCTCTCAAATCCACTCTCCTCTATTTGAGCAGATGATACTGACATGAAGCGTGGGAACACAGCGGGCAGCATAGCAGGCTTC
ACAACACTGATGTGTTGCAGGACAGCAGATTTGAGCACACTGCCATGTGATCCGATAGCTTGAATTGCTCGCTGCATTTTGTTCTGCGTGGCCACGGGAC
TGAGCTTCGGTTGTGGGAGGAGCAGCGAGTTG
page-top