Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1431
Contig Information
Length 1112 bp
Tissue Shoot with ABA treatment
Clones 12 Clones [Download: CSV  ,  FASTA ]
whva11b15    whva11j15    whva18p08    whva18p20    whva19c17    whva20f06    whva4d19    rwhva18p08    rwhva19c17    rwhva20f06    rwhva11b15    rwhva11j15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Precursor of CP29, core chlorophyll a/b binding (CAB) protein of photosystem II (PSII) [Hordeum vulgare subsp. vulgare] >gi|445122|prf||1908428A chlorophyll a/b-binding protein
Score 1332
Evalue 6.00503e-145
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1431
TGCTGAGCTGAGCACGCCCCTTCTCTCTCAACTTTGGGCTCGAGGCAATGGCGGCGCTCGCTCCGACGAAGATGCTCGGCACCCGGCTCAACTTCGCCGG
CTCCTCCAGGTACGCCACAGCGGCACCAACTGCTGGCGCACAGAAGATCGTCTCCCTCTTTGATCGCTTCAAGAAGAAGCCTGCCCCGAAGCCGAAGCCC
GCCCCCGTGGCCACCTCGAGCGTAGGCATCGACGACGAGCTCGCCAAGTGGTACGGCCCTGACAGGAGGATCTACTTGCCCAACGGACTCCTTGACCGGT
CGGAGGTGCCGGAGTACCTCAACGGAGAGGTTCCCGGAGACTACGGCTATGATCCTTTTGGTCTGGGCAAGAAGCCAGAGGACTTCGCCAAGTACCAGGC
CTTTGAGCTCATCCATGCCAGGTGGGCCATGCTCGGCGCCGCCGGATTCATCATCCCCGAGGCGCTCAACAAGTTCGGCGCAAACTGCGGTCCCGAGGCC
GTTTGGTTCAAGACTGGCGCCCTTCTCCTTGACGGCAACACCCTCAACTACTTCGGCAACAGCATCCCCATCAACCTGATCCTCGCCGTCGTCGCCGAGG
TCGTCCTCGTCGGAGGCGCCGAGTACTACAGGATCACCAACGGACTGGAATTTGATGACAAGCTCCACCCCGGTGGCCCATTCGACCCGCTCGGCCTCGC
CACCGACCCCGACCAGGCGGCGCTGCTCAAGGTGAAGGAGATCAAGAACGGACGGCTGGCCATGTTCTCCATGCTGGGCTTCTTCATCCAGGCCTACGTC
ACCGGCGAGGGCCCCTTGGAGAACCTGTGCGCGCACCTCAGCGACCCCTTCGGCAACAACCTGCTCACCGTCATCTCCGGCGCCGCCGAGAGGGTGCCCA
GCCTGTGAGCTGGCCGTTGATTGCCCGTCCGCCGCCGTCGGCTGTTGATGGATCAGCTGCGTGCGATGCGCGCGATGCAGCATCATGTGCTGTGTGAATT
TTACCGGGGAAAAGTATGAGAGTACGAATGTGCCGTACGTGTAAATTATCAAGGGGCAGAAGAAACATGACCGTTCTGATTTCTGATGGGAGTATCGGAC
CACTGCTACTGA
page-top