Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1428
Contig Information
Length 784 bp
Tissue Shoot with ABA treatment
Clones 12 Clones [Download: CSV  ,  FASTA ]
whva11e15    whva13k16    whva15g11    whva17o11    whva10f11    whva3a03    rwhva15g11    rwhva17o11    rwhva11e15    rwhva13k16    rwhva10f11    rwhva3a03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit temperature stress-induced lipocalin [Triticum aestivum]
Score 997
Evalue 2.34554e-106
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1428
CGAATCCACCGATCAGGAAGCGAGGCACAGACCGAACAGCTAGCGCACGGTGATCGACGATGGCGGCCAAGAAGAGCGGGAGCGAGATGGGCGTGGTGCT
GGGGCTGGACGTTGCCCGGTACATGGGGCGGTGGTACGAGATCGCGTCCTTCCCCAACTTCTTCCAGCCGCGCGACGGGCGCGACACGCGGGCGACCTAC
GAGCTCATGGAGGACGGCGCCACGGTGCACGTGCTCAACGAGACGTGGAGCAAAGGCAAGCGCGACTACATCGAGGGCACCGCCTACAAGGCCGACCCGG
CCAGCGAGGAGGCCAAGCTCAAGGTCAAGTTCTACGTCCCGCCGTTCCTCCCCATCATCCCCGTCGTCGGCGACTACTGGGTCCTCTATGTCGATGACGA
CTACCAGTATGCCCTCGTCGGCGAGCCCCGCCGGAAAAGCCTATGGATCCTGTGCAGGAAGACGCACATCGAGGACGAGGTGTACAACCAGCTGCTGGAG
AAGGCCAAGGAGGAAGGCTACGACGTGGCCAAGCTGCACAAGACGCCGCAGAGCGACCCGCCGCCGGAGAGCGATGCCGCGCCCACCGACAGCAAAGGGA
CCTGGTGGTTCAAGTCGCTCTTTGGTAAATGATGGATTCATCCGTATGTATATGCAGTTGGCCGGCACTGTAACAGCCATGATGTGTGTTCATCTGTATC
TTAGTGTATTAGCTAATCTTTATGGTGTCCAATAAATAAATCAGACTCAGTGATATAGTACTACCGTTTTCAGGAAAAAAAAAA
page-top