Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1427
Contig Information
Length 1151 bp
Tissue Shoot with ABA treatment
Clones 12 Clones [Download: CSV  ,  FASTA ]
whva3i09    whva4l09    whva5i05    rwhva15e08    rwhva11b24    rwhva11h07    rwhva14a01    rwhva10b01    rwhva10c07    rwhva2n21    rwhva3i09    rwhva6o16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Ribulose bisphosphate carboxylase/oxygenase activase A, chloroplastic; Short=RuBisCO activase A; Short=RA A; Flags: Precursor >gi|167097|gb|AAA63164.1| ribulose 1,5-bisphosphate carboxylase activase isoform 2 [Hordeum vulgare subsp. vulgare]
Score 1746
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1427
TATTTGTCTTTACCAAATAGGTATACTCAATATCTTTTTATATTAACAAAACATGCCCAGCAATCGCTTGGATGCGATGCGGTACTTAGGTACAAAGGAT
AAAACATCAGATATTAAATTGGCATGCTTAAAAGGTGTAAAGGCAGCTCCCGTCGTCACTCCTCGCCGTTGGGTCGAAGTTCTTGGCAGTCTGGTCGGTG
CATCCTGCCGGTACAGGCAAAGTACCTTGCTGTGCCCCTTTACCGTAGAAGGAACCAGTCTTCATCGCATCCTGGTTAGCATCACCCAGAGCTGCCTGGC
TCATGTAGGTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCCTGGACAAGCATGTGCCCGTACTCTAGCAGCTTCTCCACTGTCATCTTTGGCTG
CTCAAAGGTCACTGGTCCGTCCCGCGAGTTCACCAGCTTCTTGCCAATGTTCTCGATACCGGTAGAGGTCACCCACTTGCGCACCTCGTCGTCGTACACC
CGAGCACGCAGAGCACCGAAAAAGTCGATGGATTGTCCTGGGAAGGTGTCGACGATCTTGACGACGGACTCGTCGCTGACATTGTCGGTCTGGAAGATAC
CCTTGCAGACACCGATACGGTCGTCGCGGGTGGGAGCCCAGTAGAACTTCTCCATACGACCATCACGGATCAGAGGGGCGTACAACGTCGAGAAATCGTT
ACCAGTGACGACGATGGGCACACGTGGGTTCTCCTCCTTGTTGTACATGCCTGGGAGCTGCACATTGGTGGGGGCATCGGCGATGTTCATGAGGGTGGCG
TTCACCATCTGGTTGTTGACGGTGTACTGTGTGGTCCCGCCCATCCTACCCGCACCGGCGTCAAGATCGTTGATGAAGAGGCAGCACATCTTACCCTTCT
TGATCATGTCTGCAGCCTCACGGTACCGCTGCCTGATGAGCTTGGCTGGCTCTCCGGCGTTGCCACTCTCCAGCTCTCCGGCACTCATCATGATTGGGTT
GATGCCCATCTTGGCGAAGACAAGCTCACACTGGAAGGATTTTCCTTGACCCTTGCCTCCCCAGATACCCAAGATGAGTGGGATCTTGATGTTGGGCAGG
GTCATGAAGTTCTTGGAGAGATGGACAACAAGCTTGTCCAGAAAGCAGGAG
page-top