Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1426
Contig Information
Length 1358 bp
Tissue Shoot with ABA treatment
Clones 12 Clones [Download: CSV  ,  FASTA ]
whva12j08    whva15d16    whva18o22    whva1i07    whva7h03    whva7o23    rwhva15d16    rwhva11m21    rwhva12j08    rwhva13p20    rwhva1i07    rwhva7o23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os07g0152900 [Oryza sativa (japonica cultivar-group)] >gi|34395056|dbj|BAC84719.1| putative glycolate oxidase [Oryza sativa Japonica Group] >gi|50508805|dbj|BAD31578.1| putative (S)-2-hydroxy-acid oxidase [Oryza sativa Japonica Group] >gi|113610445|dbj|BAF20823.1| Os07g0152900 [Oryza sativa (japonica cultivar-group)] >gi|215678898|dbj|BAG96328.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215692798|dbj|BAG88242.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218199102|gb|EEC81529.1| hypothetical protein OsI_24928 [Oryza sativa Indica Group]
Score 1703
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1426
ACGTATTTAATTCATTTATCATGTTTAATCGATCCATGCCATATCACAGCACTTAGGAAGTCGGAAACACACACACACACACATCCCGTCCAAAATTAAT
TACACTAGGTAGCATTATCACGCATCGATGCCGTTACGTACGTGAGCCTTGATCGCTATACGGCCGCCGGCGACGTGGACCGACTTGATTTGGTTCCAAG
TTACAAGCGGGACGGCATGACGCCGAATTTGTCGGCCTCGGTGACGACGTGGTTGCGGGTGATGTCGGCCAGCGAGTTGCAGCCGCTCAGCGCCATGGTC
AGCTCGAACTCGTCGCGCAGCATCTTGAGCACGTTGCTCACCCCGGCCTCCCCGGCCACCGCCAGCGAGAACACCACCGGCCTTCCGATGAAGACGCCGG
CGGCGCCGAGAGCGAGCGCCTTGAAGACGTCGGTGCCGCGGCGCACACCGCCGTCCAGGAAGACGGGGATCTGCCCGCCAGCACCCTTCACGACCTCTTC
CAGGGCGCTGATGGTCGCCGGGACGTAGTCCAGTTGCCGGGCGCCGTGGTTGGACACGATGATTCCGGCCGCGCCGTTCTCGACGGCGAGCCTGCTGTCC
TCTGCGGTGATCACTCCTTTCACCAGGATCGGCATCGTGGTGATGGACTGCAGCCACTTCACATCCTTCCAGCTCAGTGTGCGGTCGATTTGGCCGGCGA
CATATGAAGCTAGTCCTGAATCGTTAGCCTGGTCCATTTTCCCGAGGTCCAAACCTTCAAAGTTCTTGAGTGTCAAATTTGGTGGCAAAACAAATCTGTT
CTTGATATCAGCTTCCCTGCGGCCAAGTCGCGGGGTGTCCACGGTGAGCGCTATCGCCTTGAATCCAGCCTTTTCCGCTCTCCTCACAAGCTGCTCGACC
ACCTTCCTGTCTTTGTAGACATAGAGTTGGAAGAAACGGATCCCTGGTCCGGTTGAGGCAACCTCCTCAACACTTGAAGTAGCCCAGGACGACAATGTCA
TTATAGTGCCTGCTGCTGATGCTGCGCGGGCAGTCGCATACTCTCCATCTGGGTGAGCCATCTTCTGCATGGCAGTGGGGGAAATCATGATGGGCATTGA
GAGCTTGAATCCCAGGATAGTTGTTGTCATGTCGATTTTGGATACATCGATCAGAATGCGCGGGCGGAACAGGATCCTGGCAAAGGCCTCCCTGTTCTCC
TGGAGCGTCCACTCGTCCTCGGCACCGGAGGCATAGTAGTCATAGATCATCTTGGGAAGCTTCTGCTTGGCGATGGCCTGGTACTCTGTGACATTGGTGA
TCTCCATTTTTCTTGTATGAGGAGGCTGTGGCTGACTGTCCCCTCAAGGCTGCCTCGT
page-top