Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1424
Contig Information
Length 784 bp
Tissue Shoot with ABA treatment
Clones 12 Clones [Download: CSV  ,  FASTA ]
whva20m06    whva20m18    whva20n05    whva20n06    whva20n17    rwhva15e01    rwhva20m06    rwhva20m18    rwhva20n05    rwhva20n06    rwhva20n17    rwhva4b07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Zea mays]
Score 1232
Evalue 1.31958e-133
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1424
TTTTTTTTTTGCGATGAGCCTTTTGTAGTGTAATGGTTGTGATTGTTCTTAATGTCTAAATACTCTCTGACTAGTCAATGGTAGCAGTTGCATCAAGCAT
AATCTGGCATGAACTTCTTAAGGAATCTTATTGGTTGAGATTCCTCAGGCACGAGCTCGTCAAAAGAAACGTAGTATCTCTCTTTGTCATACACATGGCA
TGTAGTCAATATTGTCTTCATCAACCGCCAATTCCAGCTGGCCTCATTGATATACTTGCCCCAGTTCTGTTTAATGGAGTCGTGGGCAGCACGAAGGTTA
TAACTTGGAATTCTTGGAGAAATATGGTGCGGGACGTGTACATTTATGTCATGGCAAAGGATCTCTATCCATCGAGGATAGCTACAGTGAACTGTGCCGT
TTAATTGCGCCTGTGCAGCATTCCACTCTTTTGATGATTTGAAAGGTATATGAGGAGCAGTGTGATGCACCATTGTAAAGGTGCTCATCCAAAAGTGATA
AACCATCCATGGCATGAACCAGAACTTGAACCATCCAGCTATTCCTGATTGAAGAATGATTAGGGGCCATCCAATTGCCATGAATGCAAAGACACACGCC
AAACTTATCTTCACCCTAGGGAGTTCATTTGGCCGGAATTTTTTTAGATCAAAGTGCCACATCAACCAGTGAGCAATAGACATCCATGGCCTGATAGGAC
CATAACCAAATATAATTGCCTTCCTTAGGAAAGAAGACGATTCAATTTCNTTTTGCCAAACAGGTTGCCATGCAGTATCTTCTA
page-top