Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1415
Contig Information
Length 1001 bp
Tissue Shoot with ABA treatment
Clones 11 Clones [Download: CSV  ,  FASTA ]
rwhva15c22    rwhva15g06    rwhva17c15    rwhva18h07    rwhva18n06    rwhva18n17    rwhva14c23    rwhva14k18    rwhva14l17    rwhva3k07    rwhva5a17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit alanine aminotransferase [Oryza sativa (indica cultivar-group)]
Score 917
Evalue 5.07486e-125
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1415
GTGGATCATTATTGGAGCCAACAATTACAGTATCATCATATTATGTAGTAAATGGACCGAATATTTCCGCATATATCTTCCCCCCTATACATATCAAGCA
TAGCAACCAGTTTTCTTCACCATAGTTACAGCTTACAGCTAATTAATCAACTTTAATTGCTGGTAGAAAAGAGCAGCATTGTATTATATGTAGATGCGGT
TGTCTTCTTCTCTCTTCACAGCCTCGAGTGGTCCTGGTATTGCTCCATGAACGAGTCGTTGAACTTCTTGAAGCTCGACATGATCGCCGGCATGTCCTCC
TCCGCGGGCAGGATCGTCGTCCTCAGATGGAACACCCCTTCTTTCTGACCAAAACCTGAGCCTGGAACAGTGGAAATTCCAGTGGCTTCCAGAAGCTTGA
GGCAGTAGTAAACATCGGGCGCTTTGCCAGCGCTTTTTGCTACATCCATAGCTCTTTGCGGCAGCCGTATTTGCGGGAAAGAATACATAGCTCCTTCTGT
GAAATTGCAGACAACATTTCGGCAACTATTGAAACCGTCTGTCATTATTTGTGCCCTCCTCCTTAAAGATTCAAGGATAGACTTACTTTCAGCAGAGTAC
TTCAGGTACGAGATGTCTCCAGGTTTAGGAGGGTTCACCATAAGCCCCATAAAGATCTGCCCAGGAACATTTGGACTCAGCGCGATTGATGCAACCTTGT
AAATCTCGTCGACAGTCTTGGGAGGAATATTTGTCATTTCAAAGTACCCACCACGTTGTCCACACTCTCCCCAATATCCTTTGGGACACAGTATGGAAAG
AAATCAGCTGAACTTCCCTGCTTACTGGAGGACCCATGTCAAACATAACCTTTCTTGCACTTATAAACGGACGTTCATCTTGATAAACATTCTGTTGATA
AACTTCATCTGCAAGCAGAACCAAGGTTTTCCTGATAGCAGAAGTTCAAAAGTTCCCTAATATTTGCTTCACTCAGGCATTGGCCANTAGGGTTTNCCTG
G
page-top